\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1204657395:

Variant ID: vg1204657395 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 4657395
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATTAATTAAGTTTTAATTATTACATACTTGAAAAATGAATTTATTGGATATTTGAGAGCAACTCTATATGGAAAGTTTTCGCAAGACACACACCGTTTA[T/G]
TAGTTTGAAAAACATGCTAACGAAAACCGATGTAAAATATGCATTATTAGTTTCTGGCCCATAAAGACTTGTACATAGAATTTGAGAAATTGTGCATTTT

Reverse complement sequence

AAAATGCACAATTTCTCAAATTCTATGTACAAGTCTTTATGGGCCAGAAACTAATAATGCATATTTTACATCGGTTTTCGTTAGCATGTTTTTCAAACTA[A/C]
TAAACGGTGTGTGTCTTGCGAAAACTTTCCATATAGAGTTGCTCTCAAATATCCAATAAATTCATTTTTCAAGTATGTAATAATTAAAACTTAATTAATC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.80% 34.10% 0.44% 0.68% NA
All Indica  2759 95.80% 2.50% 0.65% 1.01% NA
All Japonica  1512 12.60% 87.20% 0.00% 0.20% NA
Aus  269 69.10% 30.50% 0.00% 0.37% NA
Indica I  595 94.10% 1.00% 1.68% 3.19% NA
Indica II  465 96.60% 3.40% 0.00% 0.00% NA
Indica III  913 98.50% 1.20% 0.11% 0.22% NA
Indica Intermediate  786 93.60% 4.60% 0.89% 0.89% NA
Temperate Japonica  767 5.00% 94.90% 0.00% 0.13% NA
Tropical Japonica  504 8.70% 91.10% 0.00% 0.20% NA
Japonica Intermediate  241 44.80% 54.80% 0.00% 0.41% NA
VI/Aromatic  96 7.30% 92.70% 0.00% 0.00% NA
Intermediate  90 37.80% 58.90% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1204657395 T -> DEL N N silent_mutation Average:47.202; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N
vg1204657395 T -> G LOC_Os12g08920.1 upstream_gene_variant ; 2782.0bp to feature; MODIFIER silent_mutation Average:47.202; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N
vg1204657395 T -> G LOC_Os12g08930.1 upstream_gene_variant ; 372.0bp to feature; MODIFIER silent_mutation Average:47.202; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N
vg1204657395 T -> G LOC_Os12g08930-LOC_Os12g08940 intergenic_region ; MODIFIER silent_mutation Average:47.202; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1204657395 NA 3.24E-06 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204657395 NA 1.23E-06 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204657395 NA 5.29E-07 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204657395 1.50E-06 NA mr1679 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204657395 NA 8.28E-09 mr1679 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204657395 3.97E-07 NA mr1691 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204657395 5.34E-07 8.38E-10 mr1691 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204657395 6.96E-08 NA mr1693 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204657395 1.21E-07 4.69E-14 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204657395 6.83E-06 NA mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204657395 6.55E-06 3.69E-08 mr1720 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204657395 NA 1.45E-06 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204657395 NA 5.93E-06 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204657395 NA 5.81E-06 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204657395 NA 4.08E-07 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204657395 NA 1.54E-06 mr1594_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204657395 1.03E-07 NA mr1679_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204657395 NA 5.66E-07 mr1679_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204657395 2.40E-08 NA mr1691_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204657395 6.59E-06 1.18E-09 mr1691_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204657395 5.11E-06 NA mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204657395 NA 5.73E-08 mr1720_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251