\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1204616996:

Variant ID: vg1204616996 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 4616996
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.92, G: 0.08, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


GGCCTCCTTTTCACTTTCACAGTCCTCCTTTGCATCCTGCAACATCTGACCAAGATCATCCGCAGCGTCGTTATCGCCAGCATCCCTGTCCACCTCGCCC[A/G]
TTTGATTTCCTTCAAATCCAGCGTACTGAGCCCAGTCGGGAATGTTCTCGTCCTCCGCTTCATCTTCTTCCATTTCAACCCCTTGCTCACCGTGGGATGT

Reverse complement sequence

ACATCCCACGGTGAGCAAGGGGTTGAAATGGAAGAAGATGAAGCGGAGGACGAGAACATTCCCGACTGGGCTCAGTACGCTGGATTTGAAGGAAATCAAA[T/C]
GGGCGAGGTGGACAGGGATGCTGGCGATAACGACGCTGCGGATGATCTTGGTCAGATGTTGCAGGATGCAAAGGAGGACTGTGAAAGTGAAAAGGAGGCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.40% 14.40% 32.10% 9.14% NA
All Indica  2759 18.10% 12.30% 54.26% 15.44% NA
All Japonica  1512 87.60% 11.90% 0.33% 0.13% NA
Aus  269 42.40% 56.50% 0.74% 0.37% NA
Indica I  595 11.90% 12.40% 58.32% 17.31% NA
Indica II  465 20.90% 2.40% 59.57% 17.20% NA
Indica III  913 20.60% 18.10% 48.63% 12.71% NA
Indica Intermediate  786 18.10% 11.20% 54.58% 16.16% NA
Temperate Japonica  767 95.00% 4.40% 0.26% 0.26% NA
Tropical Japonica  504 91.70% 7.90% 0.40% 0.00% NA
Japonica Intermediate  241 55.60% 44.00% 0.41% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 75.60% 6.70% 14.44% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1204616996 A -> DEL LOC_Os12g08890.1 N frameshift_variant Average:26.901; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg1204616996 A -> G LOC_Os12g08890.1 missense_variant ; p.Met104Thr; MODERATE nonsynonymous_codon ; M104S Average:26.901; most accessible tissue: Zhenshan97 panicle, score: 68.538 benign 0.546 DELETERIOUS 0.01
vg1204616996 A -> G LOC_Os12g08890.1 missense_variant ; p.Met104Thr; MODERATE nonsynonymous_codon ; M104T Average:26.901; most accessible tissue: Zhenshan97 panicle, score: 68.538 benign -0.525 TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1204616996 NA 2.62E-06 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204616996 NA 1.36E-06 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204616996 2.69E-08 NA mr1679 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204616996 8.11E-07 1.29E-09 mr1679 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204616996 2.76E-09 6.11E-12 mr1691 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204616996 4.39E-08 NA mr1693 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204616996 1.30E-09 2.17E-15 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204616996 5.79E-08 1.13E-09 mr1720 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204616996 NA 6.27E-06 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204616996 NA 1.14E-06 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204616996 3.05E-06 NA mr1679_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204616996 1.23E-07 1.45E-08 mr1679_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204616996 7.15E-08 3.56E-11 mr1691_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204616996 7.63E-06 NA mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204616996 6.60E-07 2.28E-09 mr1720_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251