\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1204560575:

Variant ID: vg1204560575 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 4560575
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, T: 0.07, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:


GTGGCAGTGTGAGCATAAGTACAGTGTGGGTACGTTTAGGCATATATGCGTGTGTACGTTTGTATCTAGGATCCATCCGCATATGTAAGTGTGTGTGGCA[G/T]
TGAGCTCGCGTTGGCTCTGTTTGAGCTCACCACGACCGCGCCCCTGAATATGCCACGCCGCTTCGATGTGAGGTCGCGTCGCACCACCAATTATTAGTCT

Reverse complement sequence

AGACTAATAATTGGTGGTGCGACGCGACCTCACATCGAAGCGGCGTGGCATATTCAGGGGCGCGGTCGTGGTGAGCTCAAACAGAGCCAACGCGAGCTCA[C/A]
TGCCACACACACTTACATATGCGGATGGATCCTAGATACAAACGTACACACGCATATATGCCTAAACGTACCCACACTGTACTTATGCTCACACTGCCAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.90% 11.20% 1.46% 53.39% NA
All Indica  2759 3.80% 3.70% 2.43% 90.11% NA
All Japonica  1512 84.30% 14.90% 0.00% 0.86% NA
Aus  269 30.50% 68.80% 0.00% 0.74% NA
Indica I  595 1.50% 1.50% 2.52% 94.45% NA
Indica II  465 4.30% 1.90% 3.23% 90.54% NA
Indica III  913 2.40% 4.70% 1.97% 90.91% NA
Indica Intermediate  786 6.70% 5.20% 2.42% 85.62% NA
Temperate Japonica  767 95.30% 3.70% 0.00% 1.04% NA
Tropical Japonica  504 81.30% 17.90% 0.00% 0.79% NA
Japonica Intermediate  241 55.20% 44.40% 0.00% 0.41% NA
VI/Aromatic  96 92.70% 6.20% 0.00% 1.04% NA
Intermediate  90 61.10% 13.30% 2.22% 23.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1204560575 G -> DEL N N silent_mutation Average:74.365; most accessible tissue: Zhenshan97 flag leaf, score: 90.996 N N N N
vg1204560575 G -> T LOC_Os12g08830.1 upstream_gene_variant ; 2532.0bp to feature; MODIFIER silent_mutation Average:74.365; most accessible tissue: Zhenshan97 flag leaf, score: 90.996 N N N N
vg1204560575 G -> T LOC_Os12g08830.2 upstream_gene_variant ; 2532.0bp to feature; MODIFIER silent_mutation Average:74.365; most accessible tissue: Zhenshan97 flag leaf, score: 90.996 N N N N
vg1204560575 G -> T LOC_Os12g08820.1 downstream_gene_variant ; 4299.0bp to feature; MODIFIER silent_mutation Average:74.365; most accessible tissue: Zhenshan97 flag leaf, score: 90.996 N N N N
vg1204560575 G -> T LOC_Os12g08840.1 downstream_gene_variant ; 2337.0bp to feature; MODIFIER silent_mutation Average:74.365; most accessible tissue: Zhenshan97 flag leaf, score: 90.996 N N N N
vg1204560575 G -> T LOC_Os12g08830-LOC_Os12g08840 intergenic_region ; MODIFIER silent_mutation Average:74.365; most accessible tissue: Zhenshan97 flag leaf, score: 90.996 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1204560575 G T -0.12 -0.1 -0.14 -0.08 -0.12 -0.09

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1204560575 8.31E-06 8.31E-06 mr1048_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204560575 NA 7.65E-06 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204560575 NA 4.79E-06 mr1177_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204560575 NA 4.33E-09 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204560575 NA 2.86E-09 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204560575 1.29E-06 4.05E-06 mr1205_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204560575 1.22E-06 NA mr1224_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204560575 5.18E-06 5.18E-06 mr1259_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204560575 2.93E-06 4.10E-06 mr1263_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204560575 4.88E-06 9.09E-06 mr1306_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204560575 NA 5.39E-06 mr1308_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204560575 4.03E-06 3.23E-06 mr1407_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204560575 NA 4.45E-07 mr1594_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204560575 NA 2.05E-07 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204560575 2.55E-06 9.30E-06 mr1607_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204560575 NA 3.88E-06 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204560575 NA 2.61E-08 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204560575 1.97E-06 2.12E-06 mr1813_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204560575 NA 1.51E-09 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204560575 8.56E-06 8.56E-06 mr1853_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204560575 2.92E-06 2.93E-06 mr1906_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204560575 5.50E-06 4.63E-06 mr1924_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204560575 6.43E-06 6.43E-06 mr1940_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204560575 1.36E-06 3.21E-06 mr1960_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251