\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1204422933:

Variant ID: vg1204422933 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 4422933
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


AACACTTAGGCCGTGTTTAGATTCAAACTTTTTTCTTTAAACTTTCAACTTTTCCGTCACATCAAATATTTGGTCACATGCATGGAGCATTAAATGTGGA[C/T]
GAAAACAAACCAATTGTACAGTTTGCATGTAAATCACGAGACGAATCTTTTGAGCCTAATTACGCAATGATCTGACAATGTGGTACTACCGTAAACATTT

Reverse complement sequence

AAATGTTTACGGTAGTACCACATTGTCAGATCATTGCGTAATTAGGCTCAAAAGATTCGTCTCGTGATTTACATGCAAACTGTACAATTGGTTTGTTTTC[G/A]
TCCACATTTAATGCTCCATGCATGTGACCAAATATTTGATGTGACGGAAAAGTTGAAAGTTTAAAGAAAAAAGTTTGAATCTAAACACGGCCTAAGTGTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.90% 32.20% 5.31% 24.61% NA
All Indica  2759 63.50% 7.50% 2.07% 26.86% NA
All Japonica  1512 0.90% 75.00% 12.24% 11.90% NA
Aus  269 0.40% 46.80% 0.00% 52.79% NA
Indica I  595 78.70% 11.60% 0.50% 9.24% NA
Indica II  465 63.20% 4.10% 2.37% 30.32% NA
Indica III  913 55.90% 5.40% 3.40% 35.38% NA
Indica Intermediate  786 61.20% 9.00% 1.53% 28.24% NA
Temperate Japonica  767 1.00% 85.40% 6.52% 7.04% NA
Tropical Japonica  504 0.80% 63.50% 18.45% 17.26% NA
Japonica Intermediate  241 0.40% 66.00% 17.43% 16.18% NA
VI/Aromatic  96 1.00% 17.70% 3.12% 78.12% NA
Intermediate  90 24.40% 41.10% 6.67% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1204422933 C -> DEL N N silent_mutation Average:43.4; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg1204422933 C -> T LOC_Os12g08700-LOC_Os12g08710 intergenic_region ; MODIFIER silent_mutation Average:43.4; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1204422933 NA 9.06E-09 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204422933 NA 2.44E-07 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204422933 NA 1.57E-07 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204422933 NA 5.43E-07 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204422933 NA 1.01E-06 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204422933 NA 1.83E-07 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204422933 NA 6.67E-06 mr1200 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204422933 NA 1.94E-32 mr1237 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204422933 NA 3.51E-07 mr1237 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204422933 NA 4.78E-14 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204422933 NA 2.46E-07 mr1457 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204422933 NA 4.84E-42 mr1458 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204422933 NA 4.80E-07 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204422933 NA 1.35E-09 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204422933 NA 1.17E-07 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204422933 NA 4.17E-07 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204422933 NA 1.51E-09 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204422933 NA 1.30E-07 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204422933 NA 1.56E-08 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204422933 NA 3.77E-21 mr1457_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204422933 NA 8.52E-07 mr1457_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204422933 NA 3.89E-07 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251