Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1204422933:

Variant ID: vg1204422933 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 4422933
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:

AACACTTAGGCCGTGTTTAGATTCAAACTTTTTTCTTTAAACTTTCAACTTTTCCGTCACATCAAATATTTGGTCACATGCATGGAGCATTAAATGTGGA[C/T]
GAAAACAAACCAATTGTACAGTTTGCATGTAAATCACGAGACGAATCTTTTGAGCCTAATTACGCAATGATCTGACAATGTGGTACTACCGTAAACATTT

Reverse complement sequence

AAATGTTTACGGTAGTACCACATTGTCAGATCATTGCGTAATTAGGCTCAAAAGATTCGTCTCGTGATTTACATGCAAACTGTACAATTGGTTTGTTTTC[G/A]
TCCACATTTAATGCTCCATGCATGTGACCAAATATTTGATGTGACGGAAAAGTTGAAAGTTTAAAGAAAAAAGTTTGAATCTAAACACGGCCTAAGTGTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	37.90%	32.20%	5.31%	24.61%	NA
All Indica	2759	63.50%	7.50%	2.07%	26.86%	NA
All Japonica	1512	0.90%	75.00%	12.24%	11.90%	NA
Aus	269	0.40%	46.80%	0.00%	52.79%	NA
Indica I	595	78.70%	11.60%	0.50%	9.24%	NA
Indica II	465	63.20%	4.10%	2.37%	30.32%	NA
Indica III	913	55.90%	5.40%	3.40%	35.38%	NA
Indica Intermediate	786	61.20%	9.00%	1.53%	28.24%	NA
Temperate Japonica	767	1.00%	85.40%	6.52%	7.04%	NA
Tropical Japonica	504	0.80%	63.50%	18.45%	17.26%	NA
Japonica Intermediate	241	0.40%	66.00%	17.43%	16.18%	NA
VI/Aromatic	96	1.00%	17.70%	3.12%	78.12%	NA
Intermediate	90	24.40%	41.10%	6.67%	27.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1204422933	C -> DEL	N	N	silent_mutation	Average:43.4; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg1204422933	C -> T	LOC_Os12g08700-LOC_Os12g08710	intergenic_region ; MODIFIER	silent_mutation	Average:43.4; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1204422933	NA	9.06E-09	mr1068	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204422933	NA	2.44E-07	mr1090	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204422933	NA	1.57E-07	mr1096	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204422933	NA	5.43E-07	mr1111	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204422933	NA	1.01E-06	mr1121	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204422933	NA	1.83E-07	mr1144	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204422933	NA	6.67E-06	mr1200	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204422933	NA	1.94E-32	mr1237	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204422933	NA	3.51E-07	mr1237	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204422933	NA	4.78E-14	mr1457	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204422933	NA	2.46E-07	mr1457	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204422933	NA	4.84E-42	mr1458	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204422933	NA	4.80E-07	mr1458	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204422933	NA	1.35E-09	mr1068_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204422933	NA	1.17E-07	mr1090_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204422933	NA	4.17E-07	mr1096_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204422933	NA	1.51E-09	mr1111_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204422933	NA	1.30E-07	mr1121_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204422933	NA	1.56E-08	mr1144_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204422933	NA	3.77E-21	mr1457_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204422933	NA	8.52E-07	mr1457_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204422933	NA	3.89E-07	mr1458_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251