| Variant ID: vg1204385807 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 4385807 |
| Reference Allele: A | Alternative Allele: G,T |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TGGCATGTCGGCACACGGAAACGTGTCGTGGGGCTGTGTCTTGTGGGTACATTTGTACACATCTGATCAGAGTAAAACTATTCGAATAGCCGTGCCCGCG[A/G,T]
TTATGGGCGGTCAACCAGATTCACCGTGATTAGACTCACCCTAGACTAGTCTAATGGAATTGAATAGTATAGGTGGATGGTTGGGCCTGTTGCAACGGGG
CCCCGTTGCAACAGGCCCAACCATCCACCTATACTATTCAATTCCATTAGACTAGTCTAGGGTGAGTCTAATCACGGTGAATCTGGTTGACCGCCCATAA[T/C,A]
CGCGGGCACGGCTATTCGAATAGTTTTACTCTGATCAGATGTGTACAAATGTACCCACAAGACACAGCCCCACGACACGTTTCCGTGTGCCGACATGCCA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 33.60% | 0.40% | 4.72% | 61.21% | T: 0.02% |
| All Indica | 2759 | 22.30% | 0.40% | 4.71% | 72.56% | T: 0.04% |
| All Japonica | 1512 | 55.40% | 0.00% | 4.10% | 40.54% | NA |
| Aus | 269 | 32.00% | 2.20% | 10.41% | 55.39% | NA |
| Indica I | 595 | 40.50% | 0.30% | 10.76% | 48.40% | NA |
| Indica II | 465 | 28.80% | 0.20% | 1.72% | 69.25% | NA |
| Indica III | 913 | 4.80% | 0.20% | 1.42% | 93.43% | T: 0.11% |
| Indica Intermediate | 786 | 24.90% | 0.80% | 5.73% | 68.58% | NA |
| Temperate Japonica | 767 | 80.20% | 0.00% | 6.00% | 13.82% | NA |
| Tropical Japonica | 504 | 27.40% | 0.00% | 0.99% | 71.63% | NA |
| Japonica Intermediate | 241 | 34.90% | 0.00% | 4.56% | 60.58% | NA |
| VI/Aromatic | 96 | 16.70% | 0.00% | 2.08% | 81.25% | NA |
| Intermediate | 90 | 40.00% | 2.20% | 1.11% | 56.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1204385807 | A -> DEL | N | N | silent_mutation | Average:6.43; most accessible tissue: Minghui63 young leaf, score: 11.521 | N | N | N | N |
| vg1204385807 | A -> G | LOC_Os12g08620.1 | downstream_gene_variant ; 2693.0bp to feature; MODIFIER | silent_mutation | Average:6.43; most accessible tissue: Minghui63 young leaf, score: 11.521 | N | N | N | N |
| vg1204385807 | A -> G | LOC_Os12g08640.1 | downstream_gene_variant ; 1924.0bp to feature; MODIFIER | silent_mutation | Average:6.43; most accessible tissue: Minghui63 young leaf, score: 11.521 | N | N | N | N |
| vg1204385807 | A -> G | LOC_Os12g08650.1 | downstream_gene_variant ; 4819.0bp to feature; MODIFIER | silent_mutation | Average:6.43; most accessible tissue: Minghui63 young leaf, score: 11.521 | N | N | N | N |
| vg1204385807 | A -> G | LOC_Os12g08620-LOC_Os12g08640 | intergenic_region ; MODIFIER | silent_mutation | Average:6.43; most accessible tissue: Minghui63 young leaf, score: 11.521 | N | N | N | N |
| vg1204385807 | A -> T | LOC_Os12g08620.1 | downstream_gene_variant ; 2693.0bp to feature; MODIFIER | silent_mutation | Average:6.43; most accessible tissue: Minghui63 young leaf, score: 11.521 | N | N | N | N |
| vg1204385807 | A -> T | LOC_Os12g08640.1 | downstream_gene_variant ; 1924.0bp to feature; MODIFIER | silent_mutation | Average:6.43; most accessible tissue: Minghui63 young leaf, score: 11.521 | N | N | N | N |
| vg1204385807 | A -> T | LOC_Os12g08650.1 | downstream_gene_variant ; 4819.0bp to feature; MODIFIER | silent_mutation | Average:6.43; most accessible tissue: Minghui63 young leaf, score: 11.521 | N | N | N | N |
| vg1204385807 | A -> T | LOC_Os12g08620-LOC_Os12g08640 | intergenic_region ; MODIFIER | silent_mutation | Average:6.43; most accessible tissue: Minghui63 young leaf, score: 11.521 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1204385807 | NA | 3.45E-18 | mr1133 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204385807 | NA | 6.34E-12 | mr1667 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204385807 | NA | 5.34E-16 | mr1133_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204385807 | NA | 5.57E-06 | mr1310_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204385807 | NA | 3.11E-08 | mr1399_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204385807 | NA | 9.03E-08 | mr1607_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204385807 | NA | 1.45E-11 | mr1667_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204385807 | 3.91E-06 | NA | mr1729_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204385807 | NA | 2.17E-12 | mr1853_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204385807 | NA | 1.85E-06 | mr1869_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |