\
| Variant ID: vg1204309286 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 4309286 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 53. )
TATTAAAGCAAGAATAATGTATCAAACAAAGGCCTAACATATTTAGATACAGCAATATCTTGATATAAAGGGCAGATTTAACATAACAATGAGGCATATA[G/A]
AATAAATATAGTTAAATCAGATACGATCGGCTGAAACTCCGATGCTATTCTAATCGGCAACTAGAAGGCAGGCTAGAGATCGATATTCTAAGCACGACTT
AAGTCGTGCTTAGAATATCGATCTCTAGCCTGCCTTCTAGTTGCCGATTAGAATAGCATCGGAGTTTCAGCCGATCGTATCTGATTTAACTATATTTATT[C/T]
TATATGCCTCATTGTTATGTTAAATCTGCCCTTTATATCAAGATATTGCTGTATCTAAATATGTTAGGCCTTTGTTTGATACATTATTCTTGCTTTAATA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.80% | 7.60% | 5.97% | 10.66% | NA |
| All Indica | 2759 | 81.50% | 10.30% | 7.54% | 0.65% | NA |
| All Japonica | 1512 | 63.60% | 4.20% | 2.84% | 29.37% | NA |
| Aus | 269 | 92.20% | 0.70% | 2.97% | 4.09% | NA |
| Indica I | 595 | 87.90% | 9.20% | 2.52% | 0.34% | NA |
| Indica II | 465 | 78.50% | 14.00% | 7.10% | 0.43% | NA |
| Indica III | 913 | 74.20% | 11.60% | 13.36% | 0.88% | NA |
| Indica Intermediate | 786 | 86.90% | 7.50% | 4.83% | 0.76% | NA |
| Temperate Japonica | 767 | 87.20% | 0.70% | 2.22% | 9.91% | NA |
| Tropical Japonica | 504 | 36.30% | 10.10% | 4.17% | 49.40% | NA |
| Japonica Intermediate | 241 | 45.60% | 2.90% | 2.07% | 49.38% | NA |
| VI/Aromatic | 96 | 59.40% | 0.00% | 15.62% | 25.00% | NA |
| Intermediate | 90 | 74.40% | 8.90% | 8.89% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1204309286 | G -> DEL | N | N | silent_mutation | Average:8.429; most accessible tissue: Callus, score: 18.724 | N | N | N | N |
| vg1204309286 | G -> A | LOC_Os12g08500.1 | upstream_gene_variant ; 1546.0bp to feature; MODIFIER | silent_mutation | Average:8.429; most accessible tissue: Callus, score: 18.724 | N | N | N | N |
| vg1204309286 | G -> A | LOC_Os12g08490.1 | downstream_gene_variant ; 420.0bp to feature; MODIFIER | silent_mutation | Average:8.429; most accessible tissue: Callus, score: 18.724 | N | N | N | N |
| vg1204309286 | G -> A | LOC_Os12g08510.1 | downstream_gene_variant ; 4864.0bp to feature; MODIFIER | silent_mutation | Average:8.429; most accessible tissue: Callus, score: 18.724 | N | N | N | N |
| vg1204309286 | G -> A | LOC_Os12g08490-LOC_Os12g08500 | intergenic_region ; MODIFIER | silent_mutation | Average:8.429; most accessible tissue: Callus, score: 18.724 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1204309286 | 4.48E-08 | 3.02E-14 | mr1191 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204309286 | 1.34E-08 | 9.93E-13 | mr1191 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204309286 | 6.23E-08 | 1.67E-13 | mr1644 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204309286 | 1.58E-08 | 1.06E-12 | mr1644 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204309286 | NA | 2.77E-14 | mr1191_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204309286 | 2.83E-06 | 4.70E-13 | mr1191_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |