\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1204309286:

Variant ID: vg1204309286 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 4309286
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 53. )

Flanking Sequence (100 bp) in Reference Genome:


TATTAAAGCAAGAATAATGTATCAAACAAAGGCCTAACATATTTAGATACAGCAATATCTTGATATAAAGGGCAGATTTAACATAACAATGAGGCATATA[G/A]
AATAAATATAGTTAAATCAGATACGATCGGCTGAAACTCCGATGCTATTCTAATCGGCAACTAGAAGGCAGGCTAGAGATCGATATTCTAAGCACGACTT

Reverse complement sequence

AAGTCGTGCTTAGAATATCGATCTCTAGCCTGCCTTCTAGTTGCCGATTAGAATAGCATCGGAGTTTCAGCCGATCGTATCTGATTTAACTATATTTATT[C/T]
TATATGCCTCATTGTTATGTTAAATCTGCCCTTTATATCAAGATATTGCTGTATCTAAATATGTTAGGCCTTTGTTTGATACATTATTCTTGCTTTAATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.80% 7.60% 5.97% 10.66% NA
All Indica  2759 81.50% 10.30% 7.54% 0.65% NA
All Japonica  1512 63.60% 4.20% 2.84% 29.37% NA
Aus  269 92.20% 0.70% 2.97% 4.09% NA
Indica I  595 87.90% 9.20% 2.52% 0.34% NA
Indica II  465 78.50% 14.00% 7.10% 0.43% NA
Indica III  913 74.20% 11.60% 13.36% 0.88% NA
Indica Intermediate  786 86.90% 7.50% 4.83% 0.76% NA
Temperate Japonica  767 87.20% 0.70% 2.22% 9.91% NA
Tropical Japonica  504 36.30% 10.10% 4.17% 49.40% NA
Japonica Intermediate  241 45.60% 2.90% 2.07% 49.38% NA
VI/Aromatic  96 59.40% 0.00% 15.62% 25.00% NA
Intermediate  90 74.40% 8.90% 8.89% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1204309286 G -> DEL N N silent_mutation Average:8.429; most accessible tissue: Callus, score: 18.724 N N N N
vg1204309286 G -> A LOC_Os12g08500.1 upstream_gene_variant ; 1546.0bp to feature; MODIFIER silent_mutation Average:8.429; most accessible tissue: Callus, score: 18.724 N N N N
vg1204309286 G -> A LOC_Os12g08490.1 downstream_gene_variant ; 420.0bp to feature; MODIFIER silent_mutation Average:8.429; most accessible tissue: Callus, score: 18.724 N N N N
vg1204309286 G -> A LOC_Os12g08510.1 downstream_gene_variant ; 4864.0bp to feature; MODIFIER silent_mutation Average:8.429; most accessible tissue: Callus, score: 18.724 N N N N
vg1204309286 G -> A LOC_Os12g08490-LOC_Os12g08500 intergenic_region ; MODIFIER silent_mutation Average:8.429; most accessible tissue: Callus, score: 18.724 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1204309286 4.48E-08 3.02E-14 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204309286 1.34E-08 9.93E-13 mr1191 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204309286 6.23E-08 1.67E-13 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204309286 1.58E-08 1.06E-12 mr1644 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204309286 NA 2.77E-14 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204309286 2.83E-06 4.70E-13 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251