Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1204309286:

Variant ID: vg1204309286 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 4309286
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 53. )

Flanking Sequence (100 bp) in Reference Genome:

TATTAAAGCAAGAATAATGTATCAAACAAAGGCCTAACATATTTAGATACAGCAATATCTTGATATAAAGGGCAGATTTAACATAACAATGAGGCATATA[G/A]
AATAAATATAGTTAAATCAGATACGATCGGCTGAAACTCCGATGCTATTCTAATCGGCAACTAGAAGGCAGGCTAGAGATCGATATTCTAAGCACGACTT

Reverse complement sequence

AAGTCGTGCTTAGAATATCGATCTCTAGCCTGCCTTCTAGTTGCCGATTAGAATAGCATCGGAGTTTCAGCCGATCGTATCTGATTTAACTATATTTATT[C/T]
TATATGCCTCATTGTTATGTTAAATCTGCCCTTTATATCAAGATATTGCTGTATCTAAATATGTTAGGCCTTTGTTTGATACATTATTCTTGCTTTAATA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.80%	7.60%	5.97%	10.66%	NA
All Indica	2759	81.50%	10.30%	7.54%	0.65%	NA
All Japonica	1512	63.60%	4.20%	2.84%	29.37%	NA
Aus	269	92.20%	0.70%	2.97%	4.09%	NA
Indica I	595	87.90%	9.20%	2.52%	0.34%	NA
Indica II	465	78.50%	14.00%	7.10%	0.43%	NA
Indica III	913	74.20%	11.60%	13.36%	0.88%	NA
Indica Intermediate	786	86.90%	7.50%	4.83%	0.76%	NA
Temperate Japonica	767	87.20%	0.70%	2.22%	9.91%	NA
Tropical Japonica	504	36.30%	10.10%	4.17%	49.40%	NA
Japonica Intermediate	241	45.60%	2.90%	2.07%	49.38%	NA
VI/Aromatic	96	59.40%	0.00%	15.62%	25.00%	NA
Intermediate	90	74.40%	8.90%	8.89%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1204309286	G -> DEL	N	N	silent_mutation	Average:8.429; most accessible tissue: Callus, score: 18.724	N	N	N	N
vg1204309286	G -> A	LOC_Os12g08500.1	upstream_gene_variant ; 1546.0bp to feature; MODIFIER	silent_mutation	Average:8.429; most accessible tissue: Callus, score: 18.724	N	N	N	N
vg1204309286	G -> A	LOC_Os12g08490.1	downstream_gene_variant ; 420.0bp to feature; MODIFIER	silent_mutation	Average:8.429; most accessible tissue: Callus, score: 18.724	N	N	N	N
vg1204309286	G -> A	LOC_Os12g08510.1	downstream_gene_variant ; 4864.0bp to feature; MODIFIER	silent_mutation	Average:8.429; most accessible tissue: Callus, score: 18.724	N	N	N	N
vg1204309286	G -> A	LOC_Os12g08490-LOC_Os12g08500	intergenic_region ; MODIFIER	silent_mutation	Average:8.429; most accessible tissue: Callus, score: 18.724	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1204309286	4.48E-08	3.02E-14	mr1191	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204309286	1.34E-08	9.93E-13	mr1191	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204309286	6.23E-08	1.67E-13	mr1644	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204309286	1.58E-08	1.06E-12	mr1644	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204309286	NA	2.77E-14	mr1191_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204309286	2.83E-06	4.70E-13	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251