Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1204232518:

Variant ID: vg1204232518 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 4232518
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGATCGGCTTGACGTCGGCAATGGCCTTCCGGTTGTCTTCGGCTTCGGGGAAGTGGAGGCCGCTCTTCCTCTCTTCGATGCGGTACCGATGGAGGCGACG[G/A]
CGCTGACCGGTGATGGCGGAGCCGACGGCTATAGCCGGCTGGAGCGGCGGCCGGAGGAGGAGAGAGATGGCTAGCGTGGGGAGAGACGGCTAGGGCACGG

Reverse complement sequence

CCGTGCCCTAGCCGTCTCTCCCCACGCTAGCCATCTCTCTCCTCCTCCGGCCGCCGCTCCAGCCGGCTATAGCCGTCGGCTCCGCCATCACCGGTCAGCG[C/T]
CGTCGCCTCCATCGGTACCGCATCGAAGAGAGGAAGAGCGGCCTCCACTTCCCCGAAGCCGAAGACAACCGGAAGGCCATTGCCGACGTCAAGCCGATCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.50%	4.70%	1.65%	21.16%	NA
All Indica	2759	76.90%	5.00%	1.05%	17.11%	NA
All Japonica	1512	62.20%	0.30%	3.04%	34.52%	NA
Aus	269	72.50%	27.50%	0.00%	0.00%	NA
Indica I	595	73.40%	2.90%	1.85%	21.85%	NA
Indica II	465	87.50%	3.20%	0.22%	9.03%	NA
Indica III	913	73.20%	6.20%	0.88%	19.72%	NA
Indica Intermediate	786	77.50%	6.10%	1.15%	15.27%	NA
Temperate Japonica	767	77.80%	0.30%	1.69%	20.21%	NA
Tropical Japonica	504	39.90%	0.00%	5.75%	54.37%	NA
Japonica Intermediate	241	58.90%	0.80%	1.66%	38.59%	NA
VI/Aromatic	96	93.80%	5.20%	1.04%	0.00%	NA
Intermediate	90	87.80%	3.30%	2.22%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1204232518	G -> DEL	LOC_Os12g08320.1	N	frameshift_variant	Average:85.91; most accessible tissue: Zhenshan97 flower, score: 98.191	N	N	N	N
vg1204232518	G -> A	LOC_Os12g08320.1	missense_variant ; p.Ala158Thr; MODERATE	nonsynonymous_codon ; A158M	Average:85.91; most accessible tissue: Zhenshan97 flower, score: 98.191	unknown	unknown	DELETERIOUS	0.00
vg1204232518	G -> A	LOC_Os12g08320.1	missense_variant ; p.Ala158Thr; MODERATE	nonsynonymous_codon ; A158T	Average:85.91; most accessible tissue: Zhenshan97 flower, score: 98.191	unknown	unknown	TOLERATED	0.21

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1204232518	G	A	-0.06	-0.05	-0.06	-0.05	-0.05	-0.06

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1204232518	NA	3.67E-06	mr1136	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204232518	2.21E-06	1.63E-06	mr1344	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251