\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1204232518:

Variant ID: vg1204232518 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 4232518
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGATCGGCTTGACGTCGGCAATGGCCTTCCGGTTGTCTTCGGCTTCGGGGAAGTGGAGGCCGCTCTTCCTCTCTTCGATGCGGTACCGATGGAGGCGACG[G/A]
CGCTGACCGGTGATGGCGGAGCCGACGGCTATAGCCGGCTGGAGCGGCGGCCGGAGGAGGAGAGAGATGGCTAGCGTGGGGAGAGACGGCTAGGGCACGG

Reverse complement sequence

CCGTGCCCTAGCCGTCTCTCCCCACGCTAGCCATCTCTCTCCTCCTCCGGCCGCCGCTCCAGCCGGCTATAGCCGTCGGCTCCGCCATCACCGGTCAGCG[C/T]
CGTCGCCTCCATCGGTACCGCATCGAAGAGAGGAAGAGCGGCCTCCACTTCCCCGAAGCCGAAGACAACCGGAAGGCCATTGCCGACGTCAAGCCGATCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.50% 4.70% 1.65% 21.16% NA
All Indica  2759 76.90% 5.00% 1.05% 17.11% NA
All Japonica  1512 62.20% 0.30% 3.04% 34.52% NA
Aus  269 72.50% 27.50% 0.00% 0.00% NA
Indica I  595 73.40% 2.90% 1.85% 21.85% NA
Indica II  465 87.50% 3.20% 0.22% 9.03% NA
Indica III  913 73.20% 6.20% 0.88% 19.72% NA
Indica Intermediate  786 77.50% 6.10% 1.15% 15.27% NA
Temperate Japonica  767 77.80% 0.30% 1.69% 20.21% NA
Tropical Japonica  504 39.90% 0.00% 5.75% 54.37% NA
Japonica Intermediate  241 58.90% 0.80% 1.66% 38.59% NA
VI/Aromatic  96 93.80% 5.20% 1.04% 0.00% NA
Intermediate  90 87.80% 3.30% 2.22% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1204232518 G -> DEL LOC_Os12g08320.1 N frameshift_variant Average:85.91; most accessible tissue: Zhenshan97 flower, score: 98.191 N N N N
vg1204232518 G -> A LOC_Os12g08320.1 missense_variant ; p.Ala158Thr; MODERATE nonsynonymous_codon ; A158M Average:85.91; most accessible tissue: Zhenshan97 flower, score: 98.191 unknown unknown DELETERIOUS 0.00
vg1204232518 G -> A LOC_Os12g08320.1 missense_variant ; p.Ala158Thr; MODERATE nonsynonymous_codon ; A158T Average:85.91; most accessible tissue: Zhenshan97 flower, score: 98.191 unknown unknown TOLERATED 0.21

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1204232518 G A -0.06 -0.05 -0.06 -0.05 -0.05 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1204232518 NA 3.67E-06 mr1136 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204232518 2.21E-06 1.63E-06 mr1344 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251