\
| Variant ID: vg1204022544 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 4022544 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AGGGGCTTACCAAATTTCACTGTTAACACCTGCCCCCAAATTTTGGGCTTATCAAATTTCACTGTTAACACCTGCCCCCAAATTTTGGAGTATGATAACT[C/T]
ATCCTTCAAAATTATATTATTTTTGATCTCGATGACTCCAAAATTGGTCTTACTTTGCTTCTTCAAATCGGCTTTCATGAGCCGATGCTGTCTGCATTAG
CTAATGCAGACAGCATCGGCTCATGAAAGCCGATTTGAAGAAGCAAAGTAAGACCAATTTTGGAGTCATCGAGATCAAAAATAATATAATTTTGAAGGAT[G/A]
AGTTATCATACTCCAAAATTTGGGGGCAGGTGTTAACAGTGAAATTTGATAAGCCCAAAATTTGGGGGCAGGTGTTAACAGTGAAATTTGGTAAGCCCCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 27.60% | 6.50% | 0.38% | 65.53% | NA |
| All Indica | 2759 | 7.10% | 0.40% | 0.43% | 92.03% | NA |
| All Japonica | 1512 | 62.80% | 19.00% | 0.20% | 17.99% | NA |
| Aus | 269 | 10.40% | 0.00% | 0.74% | 88.85% | NA |
| Indica I | 595 | 2.70% | 0.20% | 0.67% | 96.47% | NA |
| Indica II | 465 | 17.00% | 0.60% | 0.43% | 81.94% | NA |
| Indica III | 913 | 4.20% | 0.10% | 0.11% | 95.62% | NA |
| Indica Intermediate | 786 | 8.00% | 0.90% | 0.64% | 90.46% | NA |
| Temperate Japonica | 767 | 83.40% | 11.70% | 0.26% | 4.56% | NA |
| Tropical Japonica | 504 | 42.30% | 26.40% | 0.00% | 31.35% | NA |
| Japonica Intermediate | 241 | 40.20% | 26.60% | 0.41% | 32.78% | NA |
| VI/Aromatic | 96 | 85.40% | 0.00% | 0.00% | 14.58% | NA |
| Intermediate | 90 | 53.30% | 8.90% | 1.11% | 36.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1204022544 | C -> DEL | N | N | silent_mutation | Average:12.226; most accessible tissue: Callus, score: 54.315 | N | N | N | N |
| vg1204022544 | C -> T | LOC_Os12g07910.1 | downstream_gene_variant ; 3077.0bp to feature; MODIFIER | silent_mutation | Average:12.226; most accessible tissue: Callus, score: 54.315 | N | N | N | N |
| vg1204022544 | C -> T | LOC_Os12g07920.1 | downstream_gene_variant ; 1136.0bp to feature; MODIFIER | silent_mutation | Average:12.226; most accessible tissue: Callus, score: 54.315 | N | N | N | N |
| vg1204022544 | C -> T | LOC_Os12g07930.1 | downstream_gene_variant ; 140.0bp to feature; MODIFIER | silent_mutation | Average:12.226; most accessible tissue: Callus, score: 54.315 | N | N | N | N |
| vg1204022544 | C -> T | LOC_Os12g07920-LOC_Os12g07930 | intergenic_region ; MODIFIER | silent_mutation | Average:12.226; most accessible tissue: Callus, score: 54.315 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1204022544 | 4.90E-06 | NA | mr1076 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204022544 | 3.56E-10 | NA | mr1083 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204022544 | 8.99E-06 | NA | mr1085 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204022544 | 2.11E-06 | NA | mr1086 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204022544 | 1.63E-06 | NA | mr1203 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204022544 | 1.64E-06 | NA | mr1204 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204022544 | 3.64E-06 | NA | mr1226 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204022544 | 1.29E-06 | NA | mr1264 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204022544 | NA | 6.06E-06 | mr1345 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204022544 | NA | 3.72E-07 | mr1554 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204022544 | NA | 9.89E-06 | mr1653 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204022544 | 5.42E-06 | NA | mr1831 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |