\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1204022544:

Variant ID: vg1204022544 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 4022544
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGGGGCTTACCAAATTTCACTGTTAACACCTGCCCCCAAATTTTGGGCTTATCAAATTTCACTGTTAACACCTGCCCCCAAATTTTGGAGTATGATAACT[C/T]
ATCCTTCAAAATTATATTATTTTTGATCTCGATGACTCCAAAATTGGTCTTACTTTGCTTCTTCAAATCGGCTTTCATGAGCCGATGCTGTCTGCATTAG

Reverse complement sequence

CTAATGCAGACAGCATCGGCTCATGAAAGCCGATTTGAAGAAGCAAAGTAAGACCAATTTTGGAGTCATCGAGATCAAAAATAATATAATTTTGAAGGAT[G/A]
AGTTATCATACTCCAAAATTTGGGGGCAGGTGTTAACAGTGAAATTTGATAAGCCCAAAATTTGGGGGCAGGTGTTAACAGTGAAATTTGGTAAGCCCCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 27.60% 6.50% 0.38% 65.53% NA
All Indica  2759 7.10% 0.40% 0.43% 92.03% NA
All Japonica  1512 62.80% 19.00% 0.20% 17.99% NA
Aus  269 10.40% 0.00% 0.74% 88.85% NA
Indica I  595 2.70% 0.20% 0.67% 96.47% NA
Indica II  465 17.00% 0.60% 0.43% 81.94% NA
Indica III  913 4.20% 0.10% 0.11% 95.62% NA
Indica Intermediate  786 8.00% 0.90% 0.64% 90.46% NA
Temperate Japonica  767 83.40% 11.70% 0.26% 4.56% NA
Tropical Japonica  504 42.30% 26.40% 0.00% 31.35% NA
Japonica Intermediate  241 40.20% 26.60% 0.41% 32.78% NA
VI/Aromatic  96 85.40% 0.00% 0.00% 14.58% NA
Intermediate  90 53.30% 8.90% 1.11% 36.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1204022544 C -> DEL N N silent_mutation Average:12.226; most accessible tissue: Callus, score: 54.315 N N N N
vg1204022544 C -> T LOC_Os12g07910.1 downstream_gene_variant ; 3077.0bp to feature; MODIFIER silent_mutation Average:12.226; most accessible tissue: Callus, score: 54.315 N N N N
vg1204022544 C -> T LOC_Os12g07920.1 downstream_gene_variant ; 1136.0bp to feature; MODIFIER silent_mutation Average:12.226; most accessible tissue: Callus, score: 54.315 N N N N
vg1204022544 C -> T LOC_Os12g07930.1 downstream_gene_variant ; 140.0bp to feature; MODIFIER silent_mutation Average:12.226; most accessible tissue: Callus, score: 54.315 N N N N
vg1204022544 C -> T LOC_Os12g07920-LOC_Os12g07930 intergenic_region ; MODIFIER silent_mutation Average:12.226; most accessible tissue: Callus, score: 54.315 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1204022544 4.90E-06 NA mr1076 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204022544 3.56E-10 NA mr1083 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204022544 8.99E-06 NA mr1085 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204022544 2.11E-06 NA mr1086 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204022544 1.63E-06 NA mr1203 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204022544 1.64E-06 NA mr1204 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204022544 3.64E-06 NA mr1226 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204022544 1.29E-06 NA mr1264 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204022544 NA 6.06E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204022544 NA 3.72E-07 mr1554 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204022544 NA 9.89E-06 mr1653 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204022544 5.42E-06 NA mr1831 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251