\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1203687735:

Variant ID: vg1203687735 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 3687735
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:


GTGGAGGGATATTTTTGTCCCAGAAAAATTATTTGTGGAGAGGTATTTGTCCTTTTCACTTTCTAAACCTAGCTACACTCACTCGTCTCTCGTTCTGATC[C/T]
GGCACGCATTTGCAATTGGATAAGCAAAAGCTCCGCCGTCTCTGGCCCAAGTCCGGCGACGACTACCTCCTCGGCTCCTCTTCTGGTATTCTCACGTACA

Reverse complement sequence

TGTACGTGAGAATACCAGAAGAGGAGCCGAGGAGGTAGTCGTCGCCGGACTTGGGCCAGAGACGGCGGAGCTTTTGCTTATCCAATTGCAAATGCGTGCC[G/A]
GATCAGAACGAGAGACGAGTGAGTGTAGCTAGGTTTAGAAAGTGAAAAGGACAAATACCTCTCCACAAATAATTTTTCTGGGACAAAAATATCCCTCCAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.20% 5.40% 18.41% 8.99% NA
All Indica  2759 46.90% 8.70% 30.81% 13.59% NA
All Japonica  1512 96.60% 0.20% 0.60% 2.58% NA
Aus  269 95.20% 2.60% 1.49% 0.74% NA
Indica I  595 35.60% 18.50% 26.39% 19.50% NA
Indica II  465 51.80% 4.70% 31.18% 12.26% NA
Indica III  913 49.90% 2.10% 34.72% 13.25% NA
Indica Intermediate  786 48.90% 11.50% 29.39% 10.31% NA
Temperate Japonica  767 94.90% 0.30% 0.65% 4.17% NA
Tropical Japonica  504 99.00% 0.20% 0.40% 0.40% NA
Japonica Intermediate  241 97.10% 0.00% 0.83% 2.07% NA
VI/Aromatic  96 97.90% 0.00% 0.00% 2.08% NA
Intermediate  90 81.10% 3.30% 7.78% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1203687735 C -> DEL N N silent_mutation Average:41.835; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N
vg1203687735 C -> T LOC_Os12g07460.1 upstream_gene_variant ; 4206.0bp to feature; MODIFIER silent_mutation Average:41.835; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N
vg1203687735 C -> T LOC_Os12g07460-LOC_Os12g07470 intergenic_region ; MODIFIER silent_mutation Average:41.835; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1203687735 NA 1.69E-09 mr1138 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203687735 4.99E-06 2.11E-15 mr1707 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203687735 NA 2.80E-09 mr1707 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203687735 NA 4.04E-14 mr1728 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203687735 NA 3.21E-09 mr1728 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203687735 NA 3.64E-12 mr1860 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203687735 NA 1.43E-07 mr1860 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203687735 NA 6.42E-07 mr1138_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203687735 NA 1.22E-08 mr1707_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203687735 NA 2.43E-16 mr1728_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203687735 NA 6.10E-09 mr1728_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203687735 NA 5.22E-12 mr1860_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203687735 NA 4.12E-08 mr1860_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251