\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1203613911:

Variant ID: vg1203613911 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 3613911
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.90, G: 0.10, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


GTAGATGTCTAATCTAATCTAATCTAGCAACGCGATTTAGTCGATACCGGCAGAAACCCTAAAACGAGAAGCAGCCGATAGAGCTAAATTGATATTCTAA[T/G]
ACTAGATTAACAAAGACATATGATAAATAGGTAGGCAATATATCATCCAAACCAGAGCAATCCAAGAGGTCGAATGTACTGATGCAGCCTTGAACGACGC

Reverse complement sequence

GCGTCGTTCAAGGCTGCATCAGTACATTCGACCTCTTGGATTGCTCTGGTTTGGATGATATATTGCCTACCTATTTATCATATGTCTTTGTTAATCTAGT[A/C]
TTAGAATATCAATTTAGCTCTATCGGCTGCTTCTCGTTTTAGGGTTTCTGCCGGTATCGACTAAATCGCGTTGCTAGATTAGATTAGATTAGACATCTAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.00% 8.30% 2.90% 50.80% NA
All Indica  2759 5.90% 7.10% 4.68% 82.28% NA
All Japonica  1512 96.20% 3.00% 0.13% 0.73% NA
Aus  269 13.40% 52.00% 0.74% 33.83% NA
Indica I  595 3.00% 7.20% 2.69% 87.06% NA
Indica II  465 2.60% 12.00% 4.09% 81.29% NA
Indica III  913 7.90% 1.40% 4.38% 86.31% NA
Indica Intermediate  786 7.80% 10.80% 6.87% 74.55% NA
Temperate Japonica  767 99.00% 0.00% 0.26% 0.78% NA
Tropical Japonica  504 92.10% 7.30% 0.00% 0.60% NA
Japonica Intermediate  241 95.90% 3.30% 0.00% 0.83% NA
VI/Aromatic  96 92.70% 3.10% 1.04% 3.12% NA
Intermediate  90 61.10% 6.70% 3.33% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1203613911 T -> DEL N N silent_mutation Average:38.177; most accessible tissue: Minghui63 flag leaf, score: 77.828 N N N N
vg1203613911 T -> G LOC_Os12g07340.1 downstream_gene_variant ; 762.0bp to feature; MODIFIER silent_mutation Average:38.177; most accessible tissue: Minghui63 flag leaf, score: 77.828 N N N N
vg1203613911 T -> G LOC_Os12g07340-LOC_Os12g07350 intergenic_region ; MODIFIER silent_mutation Average:38.177; most accessible tissue: Minghui63 flag leaf, score: 77.828 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1203613911 1.10E-06 5.07E-17 mr1069 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203613911 4.58E-06 1.36E-07 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203613911 NA 1.50E-29 mr1075 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203613911 NA 1.13E-20 mr1077 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203613911 NA 1.41E-06 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203613911 NA 4.30E-27 mr1130 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203613911 NA 1.09E-16 mr1149 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203613911 NA 1.61E-21 mr1150 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203613911 NA 5.83E-06 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203613911 NA 1.15E-17 mr1441 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203613911 NA 2.14E-07 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203613911 NA 5.30E-07 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203613911 NA 2.79E-08 mr1829 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203613911 NA 6.51E-17 mr1842 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203613911 NA 3.89E-07 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203613911 NA 2.35E-11 mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203613911 NA 2.39E-07 mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203613911 NA 2.74E-09 mr1935 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203613911 NA 4.55E-37 mr1075_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203613911 NA 3.33E-26 mr1077_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203613911 NA 2.47E-28 mr1149_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203613911 NA 9.14E-32 mr1441_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203613911 NA 5.36E-08 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203613911 NA 3.25E-18 mr1592_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203613911 NA 3.28E-06 mr1915_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203613911 NA 8.36E-23 mr1933_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203613911 NA 1.97E-08 mr1933_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251