Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1203613911:

Variant ID: vg1203613911 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 3613911
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.90, G: 0.10, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:

GTAGATGTCTAATCTAATCTAATCTAGCAACGCGATTTAGTCGATACCGGCAGAAACCCTAAAACGAGAAGCAGCCGATAGAGCTAAATTGATATTCTAA[T/G]
ACTAGATTAACAAAGACATATGATAAATAGGTAGGCAATATATCATCCAAACCAGAGCAATCCAAGAGGTCGAATGTACTGATGCAGCCTTGAACGACGC

Reverse complement sequence

GCGTCGTTCAAGGCTGCATCAGTACATTCGACCTCTTGGATTGCTCTGGTTTGGATGATATATTGCCTACCTATTTATCATATGTCTTTGTTAATCTAGT[A/C]
TTAGAATATCAATTTAGCTCTATCGGCTGCTTCTCGTTTTAGGGTTTCTGCCGGTATCGACTAAATCGCGTTGCTAGATTAGATTAGATTAGACATCTAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	38.00%	8.30%	2.90%	50.80%	NA
All Indica	2759	5.90%	7.10%	4.68%	82.28%	NA
All Japonica	1512	96.20%	3.00%	0.13%	0.73%	NA
Aus	269	13.40%	52.00%	0.74%	33.83%	NA
Indica I	595	3.00%	7.20%	2.69%	87.06%	NA
Indica II	465	2.60%	12.00%	4.09%	81.29%	NA
Indica III	913	7.90%	1.40%	4.38%	86.31%	NA
Indica Intermediate	786	7.80%	10.80%	6.87%	74.55%	NA
Temperate Japonica	767	99.00%	0.00%	0.26%	0.78%	NA
Tropical Japonica	504	92.10%	7.30%	0.00%	0.60%	NA
Japonica Intermediate	241	95.90%	3.30%	0.00%	0.83%	NA
VI/Aromatic	96	92.70%	3.10%	1.04%	3.12%	NA
Intermediate	90	61.10%	6.70%	3.33%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1203613911	T -> DEL	N	N	silent_mutation	Average:38.177; most accessible tissue: Minghui63 flag leaf, score: 77.828	N	N	N	N
vg1203613911	T -> G	LOC_Os12g07340.1	downstream_gene_variant ; 762.0bp to feature; MODIFIER	silent_mutation	Average:38.177; most accessible tissue: Minghui63 flag leaf, score: 77.828	N	N	N	N
vg1203613911	T -> G	LOC_Os12g07340-LOC_Os12g07350	intergenic_region ; MODIFIER	silent_mutation	Average:38.177; most accessible tissue: Minghui63 flag leaf, score: 77.828	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1203613911	1.10E-06	5.07E-17	mr1069	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203613911	4.58E-06	1.36E-07	mr1069	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203613911	NA	1.50E-29	mr1075	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203613911	NA	1.13E-20	mr1077	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203613911	NA	1.41E-06	mr1077	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203613911	NA	4.30E-27	mr1130	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203613911	NA	1.09E-16	mr1149	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203613911	NA	1.61E-21	mr1150	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203613911	NA	5.83E-06	mr1354	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203613911	NA	1.15E-17	mr1441	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203613911	NA	2.14E-07	mr1441	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203613911	NA	5.30E-07	mr1829	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203613911	NA	2.79E-08	mr1829	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203613911	NA	6.51E-17	mr1842	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203613911	NA	3.89E-07	mr1842	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203613911	NA	2.35E-11	mr1902	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203613911	NA	2.39E-07	mr1918	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203613911	NA	2.74E-09	mr1935	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203613911	NA	4.55E-37	mr1075_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203613911	NA	3.33E-26	mr1077_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203613911	NA	2.47E-28	mr1149_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203613911	NA	9.14E-32	mr1441_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203613911	NA	5.36E-08	mr1441_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203613911	NA	3.25E-18	mr1592_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203613911	NA	3.28E-06	mr1915_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203613911	NA	8.36E-23	mr1933_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203613911	NA	1.97E-08	mr1933_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251