Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1203611892:

Variant ID: vg1203611892 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 3611892
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.02, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

TTTGAAAAATTTAAAAAACATAAGTCACATATAAAGTTCATATTTTATCACCTCATAACAGTAAAAATACTAATTATGAAAAAACTTAAAATAAGACGGA[C/T]
GATTAAAGTTGGACACGTAAATTTATGGTTGCAATTAAAATGGGACGGAGGGAGTATAATGCTCCATATATCAGTCAGTTATCGAACAAATCGCTAAATC

Reverse complement sequence

GATTTAGCGATTTGTTCGATAACTGACTGATATATGGAGCATTATACTCCCTCCGTCCCATTTTAATTGCAACCATAAATTTACGTGTCCAACTTTAATC[G/A]
TCCGTCTTATTTTAAGTTTTTTCATAATTAGTATTTTTACTGTTATGAGGTGATAAAATATGAACTTTATATGTGACTTATGTTTTTTAAATTTTTCAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.90%	16.10%	0.02%	0.00%	NA
All Indica	2759	76.40%	23.60%	0.00%	0.00%	NA
All Japonica	1512	99.60%	0.40%	0.00%	0.00%	NA
Aus	269	66.50%	33.10%	0.37%	0.00%	NA
Indica I	595	93.30%	6.70%	0.00%	0.00%	NA
Indica II	465	37.80%	62.20%	0.00%	0.00%	NA
Indica III	913	85.80%	14.20%	0.00%	0.00%	NA
Indica Intermediate	786	75.60%	24.40%	0.00%	0.00%	NA
Temperate Japonica	767	99.50%	0.50%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	87.80%	12.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1203611892	C -> T	LOC_Os12g07340.1	intron_variant ; MODIFIER	silent_mutation	Average:47.0; most accessible tissue: Minghui63 root, score: 73.351	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1203611892	1.87E-06	2.51E-08	mr1069	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203611892	NA	1.88E-06	mr1074	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203611892	7.44E-06	2.04E-06	mr1075	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203611892	NA	4.05E-07	mr1077	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203611892	NA	1.47E-06	mr1124	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203611892	NA	1.11E-07	mr1130	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203611892	NA	8.65E-07	mr1149	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203611892	NA	8.42E-06	mr1174	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203611892	NA	1.15E-06	mr1354	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203611892	3.27E-07	1.57E-09	mr1441	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203611892	NA	3.35E-09	mr1565	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203611892	NA	4.51E-06	mr1842	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203611892	NA	3.53E-08	mr1896	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203611892	NA	5.87E-08	mr1918	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203611892	NA	1.06E-08	mr1934	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203611892	NA	5.44E-12	mr1935	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203611892	NA	3.11E-07	mr1330_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203611892	NA	9.02E-09	mr1441_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203611892	NA	3.66E-06	mr1539_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203611892	NA	2.29E-06	mr1540_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203611892	NA	2.84E-06	mr1732_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203611892	NA	7.21E-07	mr1933_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251