| Variant ID: vg1203473350 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 3473350 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GAGTTACTCCCTTCGTTTCAGGTTATAAGATGTTTTGACTTTGGTCAAAGTTAAACTGCTTTAGGTTTGACCAAGTTTATAGAAAAAATAATAATATTTT[C/T]
GACCCAAGATAAATTTATTATAAAAATGTATTTAATTGTTAATTTAATAAAATGAATGTAAATATTACTATATTTCTCTATAAACATAGTCAAACTTGAA
TTCAAGTTTGACTATGTTTATAGAGAAATATAGTAATATTTACATTCATTTTATTAAATTAACAATTAAATACATTTTTATAATAAATTTATCTTGGGTC[G/A]
AAAATATTATTATTTTTTCTATAAACTTGGTCAAACCTAAAGCAGTTTAACTTTGACCAAAGTCAAAACATCTTATAACCTGAAACGAAGGGAGTAACTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.10% | 3.80% | 2.07% | 0.00% | NA |
| All Indica | 2759 | 99.70% | 0.00% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 82.40% | 11.70% | 5.89% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.20% | 0.34% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.00% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 99.60% | 0.00% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 70.40% | 19.20% | 10.43% | 0.00% | NA |
| Tropical Japonica | 504 | 99.00% | 0.40% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 85.90% | 11.60% | 2.49% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 1.10% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1203473350 | C -> T | LOC_Os12g07080.1 | downstream_gene_variant ; 1153.0bp to feature; MODIFIER | silent_mutation | Average:25.469; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg1203473350 | C -> T | LOC_Os12g07080-LOC_Os12g07100 | intergenic_region ; MODIFIER | silent_mutation | Average:25.469; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1203473350 | 1.84E-06 | NA | mr1074_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203473350 | 3.91E-06 | NA | mr1081_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203473350 | NA | 1.20E-06 | mr1221_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203473350 | NA | 6.26E-07 | mr1358_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203473350 | 3.51E-06 | 3.51E-06 | mr1474_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203473350 | 9.85E-06 | 9.85E-06 | mr1571_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203473350 | 8.13E-06 | NA | mr1748_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |