\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1202159597:

Variant ID: vg1202159597 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 2159597
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, G: 0.00, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:


CCGTTCTTTGATGACACATAGTAAGATGGGCTCCAACAGAATAAGAGAGCACAACGCCAACGGGTGTGCAGTGTCCTGAGAGCAAGTATAATAGAGGGCT[A/G]
TAAGAAGGCTGAATGCTGATGTGGATGAGAGAGGAGAGGAGAGAGATGAGAAGCGAGCTATAAGTTTACAGCCGGCTTAGGCACAAGAACCAATAAAATC

Reverse complement sequence

GATTTTATTGGTTCTTGTGCCTAAGCCGGCTGTAAACTTATAGCTCGCTTCTCATCTCTCTCCTCTCCTCTCTCATCCACATCAGCATTCAGCCTTCTTA[T/C]
AGCCCTCTATTATACTTGCTCTCAGGACACTGCACACCCGTTGGCGTTGTGCTCTCTTATTCTGTTGGAGCCCATCTTACTATGTGTCATCAAAGAACGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.60% 7.60% 0.25% 0.61% NA
All Indica  2759 94.90% 4.90% 0.07% 0.07% NA
All Japonica  1512 99.70% 0.20% 0.00% 0.07% NA
Aus  269 7.10% 79.60% 3.72% 9.67% NA
Indica I  595 98.80% 1.20% 0.00% 0.00% NA
Indica II  465 98.90% 0.90% 0.22% 0.00% NA
Indica III  913 91.80% 8.00% 0.00% 0.22% NA
Indica Intermediate  786 93.30% 6.60% 0.13% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.40% 0.00% 0.41% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1202159597 A -> DEL N N silent_mutation Average:70.259; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg1202159597 A -> G LOC_Os12g04980.1 upstream_gene_variant ; 1313.0bp to feature; MODIFIER silent_mutation Average:70.259; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg1202159597 A -> G LOC_Os12g04990.1 downstream_gene_variant ; 1951.0bp to feature; MODIFIER silent_mutation Average:70.259; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg1202159597 A -> G LOC_Os12g04990.2 downstream_gene_variant ; 1951.0bp to feature; MODIFIER silent_mutation Average:70.259; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg1202159597 A -> G LOC_Os12g04990.3 downstream_gene_variant ; 1951.0bp to feature; MODIFIER silent_mutation Average:70.259; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg1202159597 A -> G LOC_Os12g04990.4 downstream_gene_variant ; 2870.0bp to feature; MODIFIER silent_mutation Average:70.259; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg1202159597 A -> G LOC_Os12g04980-LOC_Os12g04990 intergenic_region ; MODIFIER silent_mutation Average:70.259; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1202159597 NA 4.09E-07 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202159597 NA 4.87E-06 mr1054 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202159597 NA 1.12E-23 mr1095 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202159597 NA 3.43E-32 mr1098 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202159597 NA 1.35E-31 mr1099 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202159597 NA 2.18E-28 mr1101 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202159597 NA 4.36E-15 mr1113 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202159597 NA 1.23E-16 mr1119 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202159597 NA 5.07E-06 mr1153 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202159597 NA 4.52E-15 mr1158 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202159597 NA 4.62E-06 mr1184 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202159597 NA 6.89E-07 mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202159597 NA 1.23E-13 mr1231 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202159597 NA 1.67E-17 mr1240 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202159597 NA 4.33E-21 mr1247 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202159597 NA 3.86E-07 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202159597 NA 6.77E-06 mr1287 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202159597 NA 7.18E-06 mr1331 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202159597 NA 2.28E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202159597 NA 2.44E-08 mr1348 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202159597 NA 9.24E-06 mr1351 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202159597 3.08E-06 3.17E-10 mr1365 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202159597 NA 7.22E-06 mr1367 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202159597 NA 7.96E-06 mr1372 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202159597 NA 7.61E-07 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202159597 NA 2.96E-06 mr1393 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202159597 NA 1.98E-11 mr1409 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202159597 NA 2.50E-06 mr1417 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202159597 NA 7.23E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202159597 NA 3.21E-06 mr1427 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202159597 NA 3.22E-14 mr1496 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202159597 NA 3.94E-06 mr1512 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202159597 NA 7.82E-20 mr1515 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202159597 NA 1.11E-06 mr1556 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202159597 NA 9.30E-27 mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202159597 NA 2.10E-25 mr1589 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202159597 NA 5.98E-11 mr1612 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202159597 NA 6.91E-06 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202159597 NA 2.50E-07 mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202159597 NA 3.85E-12 mr1649 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202159597 NA 3.03E-10 mr1696 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202159597 NA 3.04E-07 mr1762 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202159597 NA 2.29E-07 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202159597 NA 9.17E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202159597 NA 1.08E-25 mr1858 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202159597 NA 9.88E-26 mr1859 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202159597 NA 1.29E-26 mr1868 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202159597 NA 2.51E-17 mr1911 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202159597 NA 6.06E-10 mr1939 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202159597 NA 1.41E-19 mr1961 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202159597 NA 1.40E-20 mr1095_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202159597 NA 1.26E-31 mr1098_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202159597 NA 1.07E-26 mr1099_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202159597 NA 9.96E-12 mr1409_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202159597 NA 4.26E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202159597 NA 4.58E-13 mr1803_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251