Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1202107188:

Variant ID: vg1202107188 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 2107188
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:

AGCTCAGGAATATGGGTTGTAAGGTATTTATGCTTTTATTGTTATTATAAGTATGTATCTAATTTCCCCATTATTTTACCTCTATGTAAGTCCGTCTTAT[T/A]
TATTCGCTCTCATGCAAAATGATCTATGCATAAAATTTCGCTCTTATTCGATTCTGTTATTTGAGTCCTTTATTGCTTTATTTAATTTGGATTTGAGCAT

Reverse complement sequence

ATGCTCAAATCCAAATTAAATAAAGCAATAAAGGACTCAAATAACAGAATCGAATAAGAGCGAAATTTTATGCATAGATCATTTTGCATGAGAGCGAATA[A/T]
ATAAGACGGACTTACATAGAGGTAAAATAATGGGGAAATTAGATACATACTTATAATAACAATAAAAGCATAAATACCTTACAACCCATATTCCTGAGCT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.00%	14.10%	1.84%	9.06%	NA
All Indica	2759	60.90%	24.00%	2.68%	12.50%	NA
All Japonica	1512	94.20%	0.10%	0.79%	4.89%	NA
Aus	269	99.60%	0.00%	0.37%	0.00%	NA
Indica I	595	25.50%	53.40%	3.70%	17.31%	NA
Indica II	465	66.00%	12.50%	3.23%	18.28%	NA
Indica III	913	78.80%	12.00%	1.75%	7.45%	NA
Indica Intermediate	786	63.70%	22.30%	2.67%	11.32%	NA
Temperate Japonica	767	95.70%	0.00%	0.65%	3.65%	NA
Tropical Japonica	504	89.70%	0.40%	1.19%	8.73%	NA
Japonica Intermediate	241	98.80%	0.00%	0.41%	0.83%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	84.40%	5.60%	0.00%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1202107188	T -> DEL	N	N	silent_mutation	Average:17.305; most accessible tissue: Zhenshan97 flag leaf, score: 29.417	N	N	N	N
vg1202107188	T -> A	LOC_Os12g04900.1	upstream_gene_variant ; 131.0bp to feature; MODIFIER	silent_mutation	Average:17.305; most accessible tissue: Zhenshan97 flag leaf, score: 29.417	N	N	N	N
vg1202107188	T -> A	LOC_Os12g04910.1	upstream_gene_variant ; 1337.0bp to feature; MODIFIER	silent_mutation	Average:17.305; most accessible tissue: Zhenshan97 flag leaf, score: 29.417	N	N	N	N
vg1202107188	T -> A	LOC_Os12g04890.1	downstream_gene_variant ; 4555.0bp to feature; MODIFIER	silent_mutation	Average:17.305; most accessible tissue: Zhenshan97 flag leaf, score: 29.417	N	N	N	N
vg1202107188	T -> A	LOC_Os12g04890-LOC_Os12g04900	intergenic_region ; MODIFIER	silent_mutation	Average:17.305; most accessible tissue: Zhenshan97 flag leaf, score: 29.417	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1202107188	1.38E-06	1.15E-42	mr1026	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202107188	NA	4.26E-21	mr1026	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202107188	NA	2.42E-15	mr1118	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202107188	NA	6.13E-17	mr1118	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202107188	NA	4.89E-06	mr1120	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202107188	1.13E-06	1.69E-40	mr1161	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202107188	NA	8.35E-20	mr1161	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202107188	NA	2.33E-06	mr1247	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202107188	NA	8.32E-06	mr1261	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202107188	NA	6.10E-17	mr1495	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202107188	NA	3.98E-07	mr1496	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202107188	NA	7.00E-08	mr1794	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202107188	NA	2.54E-19	mr1118_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202107188	8.25E-06	1.92E-23	mr1118_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202107188	NA	6.76E-08	mr1120_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202107188	3.42E-08	8.28E-44	mr1161_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202107188	1.12E-06	5.11E-23	mr1161_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202107188	NA	8.41E-07	mr1247_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202107188	NA	1.78E-25	mr1495_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202107188	4.20E-06	3.28E-23	mr1495_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202107188	NA	2.39E-08	mr1496_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202107188	NA	7.84E-07	mr1936_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251