Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1201963046:

Variant ID: vg1201963046 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 1963046
Reference Allele: C	Alternative Allele: T,A
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACTTTTGATAGTCATATTTTATCTTGGCACACAAACTAAGGATAATTATATTATCCATTTAAACATGCTACTACTCCTTCCGGTTTCATTTTAATTGACG[C/T,A]
TTTGGACAATGACACGCTCTACAAGATATACCTTTGACCTTATTTTTCTATTATAATATATACAATAAATAAATATATGTTTACTTTTATTGTAGTTTTT

Reverse complement sequence

AAAAACTACAATAAAAGTAAACATATATTTATTTATTGTATATATTATAATAGAAAAATAAGGTCAAAGGTATATCTTGTAGAGCGTGTCATTGTCCAAA[G/A,T]
CGTCAATTAAAATGAAACCGGAAGGAGTAGTAGCATGTTTAAATGGATAATATAATTATCCTTAGTTTGTGTGCCAAGATAAAATATGACTATCAAAAGT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.90%	35.90%	0.61%	7.62%	A: 0.02%
All Indica	2759	92.50%	2.50%	0.43%	4.53%	NA
All Japonica	1512	2.50%	97.20%	0.26%	0.07%	NA
Aus	269	7.40%	3.70%	3.35%	85.50%	NA
Indica I	595	97.80%	0.30%	0.50%	1.34%	NA
Indica II	465	95.70%	3.70%	0.00%	0.65%	NA
Indica III	913	91.20%	1.40%	0.77%	6.57%	NA
Indica Intermediate	786	88.20%	4.70%	0.25%	6.87%	NA
Temperate Japonica	767	4.20%	95.70%	0.13%	0.00%	NA
Tropical Japonica	504	1.00%	98.40%	0.40%	0.20%	NA
Japonica Intermediate	241	0.40%	99.20%	0.41%	0.00%	NA
VI/Aromatic	96	3.10%	92.70%	2.08%	1.04%	A: 1.04%
Intermediate	90	30.00%	64.40%	2.22%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1201963046	C -> DEL	N	N	silent_mutation	Average:55.579; most accessible tissue: Callus, score: 82.9	N	N	N	N
vg1201963046	C -> A	LOC_Os12g04630.1	upstream_gene_variant ; 709.0bp to feature; MODIFIER	silent_mutation	Average:55.579; most accessible tissue: Callus, score: 82.9	N	N	N	N
vg1201963046	C -> A	LOC_Os12g04640.1	upstream_gene_variant ; 3034.0bp to feature; MODIFIER	silent_mutation	Average:55.579; most accessible tissue: Callus, score: 82.9	N	N	N	N
vg1201963046	C -> A	LOC_Os12g04620.1	downstream_gene_variant ; 2642.0bp to feature; MODIFIER	silent_mutation	Average:55.579; most accessible tissue: Callus, score: 82.9	N	N	N	N
vg1201963046	C -> A	LOC_Os12g04630-LOC_Os12g04640	intergenic_region ; MODIFIER	silent_mutation	Average:55.579; most accessible tissue: Callus, score: 82.9	N	N	N	N
vg1201963046	C -> T	LOC_Os12g04630.1	upstream_gene_variant ; 709.0bp to feature; MODIFIER	silent_mutation	Average:55.579; most accessible tissue: Callus, score: 82.9	N	N	N	N
vg1201963046	C -> T	LOC_Os12g04640.1	upstream_gene_variant ; 3034.0bp to feature; MODIFIER	silent_mutation	Average:55.579; most accessible tissue: Callus, score: 82.9	N	N	N	N
vg1201963046	C -> T	LOC_Os12g04620.1	downstream_gene_variant ; 2642.0bp to feature; MODIFIER	silent_mutation	Average:55.579; most accessible tissue: Callus, score: 82.9	N	N	N	N
vg1201963046	C -> T	LOC_Os12g04630-LOC_Os12g04640	intergenic_region ; MODIFIER	silent_mutation	Average:55.579; most accessible tissue: Callus, score: 82.9	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1201963046	NA	6.07E-34	mr1026	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	8.00E-07	mr1053	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	1.43E-27	mr1076	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	6.63E-08	mr1076	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	4.41E-07	mr1082	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	1.25E-23	mr1083	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	2.28E-06	mr1083	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	5.23E-06	mr1086	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	1.52E-61	mr1088	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	1.00E-06	mr1088	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	3.23E-10	mr1103	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	8.91E-34	mr1104	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	9.80E-06	3.28E-09	mr1104	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	8.10E-08	mr1107	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	2.31E-45	mr1108	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	3.68E-44	mr1112	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	2.82E-20	mr1131	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	2.54E-41	mr1139	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	1.47E-09	mr1139	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	4.51E-29	mr1145	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	6.97E-08	mr1145	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	1.34E-17	mr1147	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	1.51E-33	mr1161	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	7.86E-15	mr1199	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	8.95E-32	mr1204	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	7.66E-07	mr1204	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	9.90E-35	mr1224	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	2.80E-34	mr1225	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	1.15E-29	mr1226	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	7.62E-10	mr1226	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	4.28E-12	mr1233	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	4.19E-64	mr1246	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	4.09E-08	mr1260	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	1.07E-14	mr1261	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	3.30E-25	mr1264	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	8.73E-10	mr1342	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	8.41E-36	mr1404	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	8.84E-06	mr1404	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	8.59E-27	mr1411	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	2.16E-06	6.18E-12	mr1411	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	2.32E-31	mr1436	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	1.19E-07	mr1436	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	9.18E-42	mr1437	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	4.07E-10	mr1437	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	8.61E-32	mr1560	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	3.47E-06	5.53E-11	mr1560	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	7.42E-40	mr1620	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	2.87E-06	mr1620	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	1.78E-13	mr1655	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	3.53E-34	mr1878	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	1.04E-06	mr1878	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	9.48E-06	mr1949	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	2.35E-49	mr1063_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	1.79E-74	mr1088_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	2.20E-44	mr1094_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	2.39E-18	mr1131_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	2.49E-50	mr1144_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	1.94E-12	mr1147_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	4.61E-34	mr1161_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	2.35E-17	mr1199_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	3.06E-37	mr1208_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	1.24E-37	mr1224_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	4.69E-39	mr1226_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	3.89E-27	mr1270_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	6.49E-07	mr1623_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	6.56E-11	mr1734_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	7.76E-16	mr1744_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	8.06E-39	mr1745_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201963046	NA	4.72E-10	mr1782_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251