\
| Variant ID: vg1201579614 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 1579614 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GGAGATGACAGGGACAGTGAGGGCCCCGCGGATGTCCGAAACCCAGGAGTTGTTCGCCAGGCCAGAAGCAACCGTGCGCGAACGGAGGTGCTGTGGCACA[A/G]
CGAAGAGGAGGTCAGGAGCCAAGGAGGCCACTGAGCGGCCTCCATCAATCCAATAGTCAGTCCAGAAGAGCATAGATTCACCATCCCCCGGCACGAAGAA
TTCTTCGTGCCGGGGGATGGTGAATCTATGCTCTTCTGGACTGACTATTGGATTGATGGAGGCCGCTCAGTGGCCTCCTTGGCTCCTGACCTCCTCTTCG[T/C]
TGTGCCACAGCACCTCCGTTCGCGCACGGTTGCTTCTGGCCTGGCGAACAACTCCTGGGTTTCGGACATCCGCGGGGCCCTCACTGTCCCTGTCATCTCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.40% | 35.40% | 0.23% | 0.00% | NA |
| All Indica | 2759 | 97.60% | 2.20% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 2.90% | 97.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.90% | 3.20% | 0.86% | 0.00% | NA |
| Indica III | 913 | 98.60% | 1.30% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 96.10% | 3.80% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 4.60% | 95.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.20% | 98.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.20% | 98.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 9.40% | 90.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 33.30% | 61.10% | 5.56% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1201579614 | A -> G | LOC_Os12g03840.1 | downstream_gene_variant ; 4881.0bp to feature; MODIFIER | silent_mutation | Average:62.322; most accessible tissue: Zhenshan97 panicle, score: 84.374 | N | N | N | N |
| vg1201579614 | A -> G | LOC_Os12g03860.1 | downstream_gene_variant ; 4557.0bp to feature; MODIFIER | silent_mutation | Average:62.322; most accessible tissue: Zhenshan97 panicle, score: 84.374 | N | N | N | N |
| vg1201579614 | A -> G | LOC_Os12g03860.4 | downstream_gene_variant ; 4557.0bp to feature; MODIFIER | silent_mutation | Average:62.322; most accessible tissue: Zhenshan97 panicle, score: 84.374 | N | N | N | N |
| vg1201579614 | A -> G | LOC_Os12g03860.3 | downstream_gene_variant ; 4557.0bp to feature; MODIFIER | silent_mutation | Average:62.322; most accessible tissue: Zhenshan97 panicle, score: 84.374 | N | N | N | N |
| vg1201579614 | A -> G | LOC_Os12g03860.2 | downstream_gene_variant ; 4888.0bp to feature; MODIFIER | silent_mutation | Average:62.322; most accessible tissue: Zhenshan97 panicle, score: 84.374 | N | N | N | N |
| vg1201579614 | A -> G | LOC_Os12g03840-LOC_Os12g03860 | intergenic_region ; MODIFIER | silent_mutation | Average:62.322; most accessible tissue: Zhenshan97 panicle, score: 84.374 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1201579614 | NA | 1.31E-07 | mr1076 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201579614 | NA | 4.71E-08 | mr1082 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201579614 | 3.91E-09 | 8.44E-12 | mr1083 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201579614 | 3.04E-06 | 2.70E-11 | mr1103 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201579614 | NA | 4.67E-06 | mr1104 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201579614 | NA | 6.64E-09 | mr1107 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201579614 | NA | 3.81E-27 | mr1148 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201579614 | NA | 1.72E-10 | mr1226 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201579614 | NA | 1.92E-29 | mr1256 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201579614 | 7.35E-06 | 8.57E-11 | mr1411 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201579614 | NA | 7.35E-27 | mr1414 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201579614 | NA | 4.43E-07 | mr1437 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201579614 | NA | 1.04E-06 | mr1560 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201579614 | NA | 4.36E-06 | mr1681 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201579614 | NA | 6.24E-13 | mr1924 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201579614 | NA | 1.07E-06 | mr1979 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201579614 | NA | 8.02E-24 | mr1403_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201579614 | NA | 1.76E-18 | mr1657_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |