\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1201579614:

Variant ID: vg1201579614 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 1579614
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGAGATGACAGGGACAGTGAGGGCCCCGCGGATGTCCGAAACCCAGGAGTTGTTCGCCAGGCCAGAAGCAACCGTGCGCGAACGGAGGTGCTGTGGCACA[A/G]
CGAAGAGGAGGTCAGGAGCCAAGGAGGCCACTGAGCGGCCTCCATCAATCCAATAGTCAGTCCAGAAGAGCATAGATTCACCATCCCCCGGCACGAAGAA

Reverse complement sequence

TTCTTCGTGCCGGGGGATGGTGAATCTATGCTCTTCTGGACTGACTATTGGATTGATGGAGGCCGCTCAGTGGCCTCCTTGGCTCCTGACCTCCTCTTCG[T/C]
TGTGCCACAGCACCTCCGTTCGCGCACGGTTGCTTCTGGCCTGGCGAACAACTCCTGGGTTTCGGACATCCGCGGGGCCCTCACTGTCCCTGTCATCTCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.40% 35.40% 0.23% 0.00% NA
All Indica  2759 97.60% 2.20% 0.22% 0.00% NA
All Japonica  1512 2.90% 97.10% 0.00% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 95.90% 3.20% 0.86% 0.00% NA
Indica III  913 98.60% 1.30% 0.11% 0.00% NA
Indica Intermediate  786 96.10% 3.80% 0.13% 0.00% NA
Temperate Japonica  767 4.60% 95.40% 0.00% 0.00% NA
Tropical Japonica  504 1.20% 98.80% 0.00% 0.00% NA
Japonica Intermediate  241 1.20% 98.80% 0.00% 0.00% NA
VI/Aromatic  96 9.40% 90.60% 0.00% 0.00% NA
Intermediate  90 33.30% 61.10% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1201579614 A -> G LOC_Os12g03840.1 downstream_gene_variant ; 4881.0bp to feature; MODIFIER silent_mutation Average:62.322; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N
vg1201579614 A -> G LOC_Os12g03860.1 downstream_gene_variant ; 4557.0bp to feature; MODIFIER silent_mutation Average:62.322; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N
vg1201579614 A -> G LOC_Os12g03860.4 downstream_gene_variant ; 4557.0bp to feature; MODIFIER silent_mutation Average:62.322; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N
vg1201579614 A -> G LOC_Os12g03860.3 downstream_gene_variant ; 4557.0bp to feature; MODIFIER silent_mutation Average:62.322; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N
vg1201579614 A -> G LOC_Os12g03860.2 downstream_gene_variant ; 4888.0bp to feature; MODIFIER silent_mutation Average:62.322; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N
vg1201579614 A -> G LOC_Os12g03840-LOC_Os12g03860 intergenic_region ; MODIFIER silent_mutation Average:62.322; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1201579614 NA 1.31E-07 mr1076 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201579614 NA 4.71E-08 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201579614 3.91E-09 8.44E-12 mr1083 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201579614 3.04E-06 2.70E-11 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201579614 NA 4.67E-06 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201579614 NA 6.64E-09 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201579614 NA 3.81E-27 mr1148 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201579614 NA 1.72E-10 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201579614 NA 1.92E-29 mr1256 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201579614 7.35E-06 8.57E-11 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201579614 NA 7.35E-27 mr1414 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201579614 NA 4.43E-07 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201579614 NA 1.04E-06 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201579614 NA 4.36E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201579614 NA 6.24E-13 mr1924 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201579614 NA 1.07E-06 mr1979 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201579614 NA 8.02E-24 mr1403_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201579614 NA 1.76E-18 mr1657_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251