Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1201579614:

Variant ID: vg1201579614 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 1579614
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGAGATGACAGGGACAGTGAGGGCCCCGCGGATGTCCGAAACCCAGGAGTTGTTCGCCAGGCCAGAAGCAACCGTGCGCGAACGGAGGTGCTGTGGCACA[A/G]
CGAAGAGGAGGTCAGGAGCCAAGGAGGCCACTGAGCGGCCTCCATCAATCCAATAGTCAGTCCAGAAGAGCATAGATTCACCATCCCCCGGCACGAAGAA

Reverse complement sequence

TTCTTCGTGCCGGGGGATGGTGAATCTATGCTCTTCTGGACTGACTATTGGATTGATGGAGGCCGCTCAGTGGCCTCCTTGGCTCCTGACCTCCTCTTCG[T/C]
TGTGCCACAGCACCTCCGTTCGCGCACGGTTGCTTCTGGCCTGGCGAACAACTCCTGGGTTTCGGACATCCGCGGGGCCCTCACTGTCCCTGTCATCTCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.40%	35.40%	0.23%	0.00%	NA
All Indica	2759	97.60%	2.20%	0.22%	0.00%	NA
All Japonica	1512	2.90%	97.10%	0.00%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	99.50%	0.50%	0.00%	0.00%	NA
Indica II	465	95.90%	3.20%	0.86%	0.00%	NA
Indica III	913	98.60%	1.30%	0.11%	0.00%	NA
Indica Intermediate	786	96.10%	3.80%	0.13%	0.00%	NA
Temperate Japonica	767	4.60%	95.40%	0.00%	0.00%	NA
Tropical Japonica	504	1.20%	98.80%	0.00%	0.00%	NA
Japonica Intermediate	241	1.20%	98.80%	0.00%	0.00%	NA
VI/Aromatic	96	9.40%	90.60%	0.00%	0.00%	NA
Intermediate	90	33.30%	61.10%	5.56%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1201579614	A -> G	LOC_Os12g03840.1	downstream_gene_variant ; 4881.0bp to feature; MODIFIER	silent_mutation	Average:62.322; most accessible tissue: Zhenshan97 panicle, score: 84.374	N	N	N	N
vg1201579614	A -> G	LOC_Os12g03860.1	downstream_gene_variant ; 4557.0bp to feature; MODIFIER	silent_mutation	Average:62.322; most accessible tissue: Zhenshan97 panicle, score: 84.374	N	N	N	N
vg1201579614	A -> G	LOC_Os12g03860.4	downstream_gene_variant ; 4557.0bp to feature; MODIFIER	silent_mutation	Average:62.322; most accessible tissue: Zhenshan97 panicle, score: 84.374	N	N	N	N
vg1201579614	A -> G	LOC_Os12g03860.3	downstream_gene_variant ; 4557.0bp to feature; MODIFIER	silent_mutation	Average:62.322; most accessible tissue: Zhenshan97 panicle, score: 84.374	N	N	N	N
vg1201579614	A -> G	LOC_Os12g03860.2	downstream_gene_variant ; 4888.0bp to feature; MODIFIER	silent_mutation	Average:62.322; most accessible tissue: Zhenshan97 panicle, score: 84.374	N	N	N	N
vg1201579614	A -> G	LOC_Os12g03840-LOC_Os12g03860	intergenic_region ; MODIFIER	silent_mutation	Average:62.322; most accessible tissue: Zhenshan97 panicle, score: 84.374	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1201579614	NA	1.31E-07	mr1076	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201579614	NA	4.71E-08	mr1082	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201579614	3.91E-09	8.44E-12	mr1083	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201579614	3.04E-06	2.70E-11	mr1103	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201579614	NA	4.67E-06	mr1104	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201579614	NA	6.64E-09	mr1107	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201579614	NA	3.81E-27	mr1148	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201579614	NA	1.72E-10	mr1226	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201579614	NA	1.92E-29	mr1256	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201579614	7.35E-06	8.57E-11	mr1411	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201579614	NA	7.35E-27	mr1414	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201579614	NA	4.43E-07	mr1437	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201579614	NA	1.04E-06	mr1560	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201579614	NA	4.36E-06	mr1681	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201579614	NA	6.24E-13	mr1924	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201579614	NA	1.07E-06	mr1979	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201579614	NA	8.02E-24	mr1403_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201579614	NA	1.76E-18	mr1657_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251