\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1201535604:

Variant ID: vg1201535604 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 1535604
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCAGGCCGATTCCAGCAGGATACTCTAGGGTCGAAGTTGAGCTGGTGGAAGCCGCGTACGAGGACCTCAAGTTGGACTACCCAGGAGGAGACGGTGAGAC[A/G]
CATCTACGAGACACAAGCCACGCCATTATACTATGGCGCAAGTGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGTACCATCTCCTCCGGCTC

Reverse complement sequence

GAGCCGGAGGAGATGGTACACGAGACGCCGCTTGTCGCCCAGGGAGGATGATGTACCACTTGCGCCATAGTATAATGGCGTGGCTTGTGTCTCGTAGATG[T/C]
GTCTCACCGTCTCCTCCTGGGTAGTCCAACTTGAGGTCCTCGTACGCGGCTTCCACCAGCTCAACTTCGACCCTAGAGTATCCTGCTGGAATCGGCCTGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.80% 2.90% 25.22% 25.03% NA
All Indica  2759 20.50% 4.70% 33.09% 41.68% NA
All Japonica  1512 97.30% 0.30% 2.12% 0.26% NA
Aus  269 8.90% 0.00% 83.64% 7.43% NA
Indica I  595 13.80% 4.00% 40.00% 42.18% NA
Indica II  465 7.10% 8.40% 49.46% 35.05% NA
Indica III  913 30.80% 3.00% 20.70% 45.56% NA
Indica Intermediate  786 21.50% 5.20% 32.57% 40.71% NA
Temperate Japonica  767 95.60% 0.70% 3.52% 0.26% NA
Tropical Japonica  504 98.80% 0.00% 0.79% 0.40% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 95.80% 0.00% 3.12% 1.04% NA
Intermediate  90 67.80% 2.20% 21.11% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1201535604 A -> DEL LOC_Os12g03770.1 N frameshift_variant Average:33.689; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg1201535604 A -> G LOC_Os12g03770.1 synonymous_variant ; p.Thr425Thr; LOW synonymous_codon Average:33.689; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1201535604 NA 4.14E-06 mr1076 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201535604 NA 1.42E-07 mr1086 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201535604 NA 5.72E-10 mr1088 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201535604 NA 4.01E-08 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201535604 NA 1.44E-06 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201535604 NA 3.11E-07 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201535604 NA 1.87E-06 mr1139 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201535604 NA 2.07E-07 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201535604 NA 1.77E-07 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201535604 NA 1.82E-07 mr1246 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201535604 NA 8.84E-07 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201535604 NA 6.61E-07 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201535604 NA 7.13E-07 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201535604 4.41E-06 NA mr1584 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201535604 NA 1.18E-09 mr1905 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201535604 NA 2.14E-06 mr1949 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201535604 NA 1.45E-13 mr1216_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201535604 NA 3.48E-14 mr1333_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201535604 NA 2.33E-06 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201535604 NA 8.35E-06 mr1582_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201535604 NA 1.94E-06 mr1915_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251