Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1201535604:

Variant ID: vg1201535604 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 1535604
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCAGGCCGATTCCAGCAGGATACTCTAGGGTCGAAGTTGAGCTGGTGGAAGCCGCGTACGAGGACCTCAAGTTGGACTACCCAGGAGGAGACGGTGAGAC[A/G]
CATCTACGAGACACAAGCCACGCCATTATACTATGGCGCAAGTGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGTACCATCTCCTCCGGCTC

Reverse complement sequence

GAGCCGGAGGAGATGGTACACGAGACGCCGCTTGTCGCCCAGGGAGGATGATGTACCACTTGCGCCATAGTATAATGGCGTGGCTTGTGTCTCGTAGATG[T/C]
GTCTCACCGTCTCCTCCTGGGTAGTCCAACTTGAGGTCCTCGTACGCGGCTTCCACCAGCTCAACTTCGACCCTAGAGTATCCTGCTGGAATCGGCCTGC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	46.80%	2.90%	25.22%	25.03%	NA
All Indica	2759	20.50%	4.70%	33.09%	41.68%	NA
All Japonica	1512	97.30%	0.30%	2.12%	0.26%	NA
Aus	269	8.90%	0.00%	83.64%	7.43%	NA
Indica I	595	13.80%	4.00%	40.00%	42.18%	NA
Indica II	465	7.10%	8.40%	49.46%	35.05%	NA
Indica III	913	30.80%	3.00%	20.70%	45.56%	NA
Indica Intermediate	786	21.50%	5.20%	32.57%	40.71%	NA
Temperate Japonica	767	95.60%	0.70%	3.52%	0.26%	NA
Tropical Japonica	504	98.80%	0.00%	0.79%	0.40%	NA
Japonica Intermediate	241	99.60%	0.00%	0.41%	0.00%	NA
VI/Aromatic	96	95.80%	0.00%	3.12%	1.04%	NA
Intermediate	90	67.80%	2.20%	21.11%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1201535604	A -> DEL	LOC_Os12g03770.1	N	frameshift_variant	Average:33.689; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg1201535604	A -> G	LOC_Os12g03770.1	synonymous_variant ; p.Thr425Thr; LOW	synonymous_codon	Average:33.689; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1201535604	NA	4.14E-06	mr1076	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201535604	NA	1.42E-07	mr1086	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201535604	NA	5.72E-10	mr1088	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201535604	NA	4.01E-08	mr1103	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201535604	NA	1.44E-06	mr1104	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201535604	NA	3.11E-07	mr1107	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201535604	NA	1.87E-06	mr1139	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201535604	NA	2.07E-07	mr1213	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201535604	NA	1.77E-07	mr1226	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201535604	NA	1.82E-07	mr1246	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201535604	NA	8.84E-07	mr1411	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201535604	NA	6.61E-07	mr1437	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201535604	NA	7.13E-07	mr1560	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201535604	4.41E-06	NA	mr1584	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201535604	NA	1.18E-09	mr1905	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201535604	NA	2.14E-06	mr1949	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201535604	NA	1.45E-13	mr1216_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201535604	NA	3.48E-14	mr1333_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201535604	NA	2.33E-06	mr1559_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201535604	NA	8.35E-06	mr1582_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201535604	NA	1.94E-06	mr1915_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251