\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1201443848:

Variant ID: vg1201443848 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 1443848
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGTACATATTGAAATACTTTCAATAGTATTATACATACATGTAAAGCATCATCTTCAAATTCATTTTACATATAGAGAAAAAAAGACAATAATGATATA[A/G]
ACTCGTAGTTTTAAAACTGTCAGAGTTTTTGTTTTCTAGGCTAAAGTATATGGACATTTTTTTCTAGATTTTTAGTGACGTTTGTTAGTTGGTATGCACG

Reverse complement sequence

CGTGCATACCAACTAACAAACGTCACTAAAAATCTAGAAAAAAATGTCCATATACTTTAGCCTAGAAAACAAAAACTCTGACAGTTTTAAAACTACGAGT[T/C]
TATATCATTATTGTCTTTTTTTCTCTATATGTAAAATGAATTTGAAGATGATGCTTTACATGTATGTATAATACTATTGAAAGTATTTCAATATGTACAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.10% 35.50% 0.19% 17.18% NA
All Indica  2759 78.00% 2.20% 0.22% 19.64% NA
All Japonica  1512 2.80% 97.00% 0.00% 0.20% NA
Aus  269 1.50% 1.10% 0.74% 96.65% NA
Indica I  595 87.20% 1.00% 0.00% 11.76% NA
Indica II  465 94.80% 3.40% 0.00% 1.72% NA
Indica III  913 65.70% 2.00% 0.66% 31.65% NA
Indica Intermediate  786 75.20% 2.50% 0.00% 22.26% NA
Temperate Japonica  767 4.60% 95.30% 0.00% 0.13% NA
Tropical Japonica  504 1.00% 98.80% 0.00% 0.20% NA
Japonica Intermediate  241 0.80% 98.80% 0.00% 0.41% NA
VI/Aromatic  96 2.10% 93.80% 0.00% 4.17% NA
Intermediate  90 32.20% 63.30% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1201443848 A -> DEL N N silent_mutation Average:52.783; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg1201443848 A -> G LOC_Os12g03601.1 downstream_gene_variant ; 1705.0bp to feature; MODIFIER silent_mutation Average:52.783; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg1201443848 A -> G LOC_Os12g03594.1 intron_variant ; MODIFIER silent_mutation Average:52.783; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1201443848 NA 3.18E-34 mr1026 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201443848 NA 5.17E-06 mr1076 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201443848 NA 1.63E-06 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201443848 NA 8.79E-06 mr1085 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201443848 NA 3.18E-06 mr1086 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201443848 NA 7.03E-59 mr1088 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201443848 NA 4.03E-07 mr1088 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201443848 NA 1.58E-07 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201443848 NA 6.50E-06 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201443848 NA 5.64E-10 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201443848 NA 3.85E-07 mr1139 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201443848 NA 2.44E-27 mr1145 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201443848 4.00E-08 2.62E-10 mr1145 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201443848 NA 1.39E-33 mr1161 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201443848 NA 7.25E-08 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201443848 NA 1.84E-11 mr1233 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201443848 4.40E-06 3.13E-08 mr1241 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201443848 NA 3.49E-61 mr1246 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201443848 NA 1.45E-15 mr1261 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201443848 NA 4.88E-24 mr1264 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201443848 NA 9.67E-35 mr1404 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201443848 NA 3.02E-07 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201443848 NA 1.69E-06 mr1436 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201443848 NA 2.74E-07 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201443848 NA 1.03E-12 mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201443848 NA 3.34E-07 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201443848 NA 1.33E-06 mr1620 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201443848 NA 2.63E-08 mr1717 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201443848 NA 3.34E-09 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201443848 NA 7.13E-79 mr1973 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201443848 NA 3.26E-33 mr1161_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201443848 NA 5.29E-09 mr1172_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251