\
| Variant ID: vg1201180694 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 1180694 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
AGCATCGGCGGCCACGCCGTCGACGGCTGCCGGGAGTTCATGGCGTCGGGCGCCGATGGCACCGCCGCCGCGCTCCTCTGCGCCGCCTGCGGCTGCCACC[A/G]
GAGCTTCCACAGGCGAGAGGTGGAGGCCGCCGCGGCCGAATGCGACTGCTCCTCCGACACCTCCTCCGGCACCGGCCGCCGGTGATCGCCGTGGATTTGA
TCAAATCCACGGCGATCACCGGCGGCCGGTGCCGGAGGAGGTGTCGGAGGAGCAGTCGCATTCGGCCGCGGCGGCCTCCACCTCTCGCCTGTGGAAGCTC[T/C]
GGTGGCAGCCGCAGGCGGCGCAGAGGAGCGCGGCGGCGGTGCCATCGGCGCCCGACGCCATGAACTCCCGGCAGCCGTCGACGGCGTGGCCGCCGATGCT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.40% | 31.20% | 1.33% | 0.00% | NA |
| All Indica | 2759 | 63.20% | 36.60% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 88.00% | 8.90% | 3.17% | 0.00% | NA |
| Aus | 269 | 1.10% | 98.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 58.80% | 41.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 90.30% | 9.20% | 0.43% | 0.00% | NA |
| Indica III | 913 | 53.70% | 46.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 61.60% | 38.00% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 90.70% | 5.10% | 4.17% | 0.00% | NA |
| Tropical Japonica | 504 | 80.80% | 16.90% | 2.38% | 0.00% | NA |
| Japonica Intermediate | 241 | 94.20% | 4.10% | 1.66% | 0.00% | NA |
| VI/Aromatic | 96 | 39.60% | 56.20% | 4.17% | 0.00% | NA |
| Intermediate | 90 | 80.00% | 14.40% | 5.56% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1201180694 | A -> G | LOC_Os12g03110.1 | missense_variant ; p.Gln78Arg; MODERATE | nonsynonymous_codon ; Q78R | Average:58.05; most accessible tissue: Minghui63 panicle, score: 85.556 | possibly damaging |
-1.945 |
TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1201180694 | NA | 1.34E-06 | mr1038 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201180694 | NA | 5.53E-06 | mr1201 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201180694 | 8.90E-08 | 9.19E-09 | mr1219 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201180694 | 8.05E-07 | 5.69E-07 | mr1274 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201180694 | NA | 9.89E-07 | mr1545 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201180694 | NA | 8.36E-06 | mr1201_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201180694 | 1.34E-06 | 2.92E-07 | mr1219_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201180694 | 7.51E-06 | 2.63E-06 | mr1274_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201180694 | 7.43E-07 | 7.43E-07 | mr1587_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201180694 | NA | 3.34E-06 | mr1591_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201180694 | 7.15E-06 | 3.27E-06 | mr1594_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201180694 | NA | 1.95E-08 | mr1829_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201180694 | 3.86E-06 | 7.02E-08 | mr1842_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1201180694 | NA | 1.72E-07 | mr1902_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |