Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1201093266:

Variant ID: vg1201093266 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 1093266
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, A: 0.06, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:

TACACAAAGGAAATAGGAGACAACAGCGAATACGATTCCATCTCAACTAATCCTGTCATAGAGATTGACAGATCAATCGGCTGGCTCAGCGAGCTACTCC[C/A]
TCCGTTTCAAAATGTTTGACACCATTGACTTTTTAGCACATATTTGACTGTTCGTCTTATTAAAAAAATTGTGAAATATGTAAAACTATATGTGTACATC

Reverse complement sequence

GATGTACACATATAGTTTTACATATTTCACAATTTTTTTAATAAGACGAACAGTCAAATATGTGCTAAAAAGTCAATGGTGTCAAACATTTTGAAACGGA[G/T]
GGAGTAGCTCGCTGAGCCAGCCGATTGATCTGTCAATCTCTATGACAGGATTAGTTGAGATGGAATCGTATTCGCTGTTGTCTCCTATTTCCTTTGTGTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.20%	26.60%	0.08%	0.06%	NA
All Indica	2759	64.30%	35.50%	0.07%	0.11%	NA
All Japonica	1512	99.70%	0.30%	0.07%	0.00%	NA
Aus	269	1.90%	97.80%	0.37%	0.00%	NA
Indica I	595	56.30%	43.70%	0.00%	0.00%	NA
Indica II	465	91.20%	8.60%	0.00%	0.22%	NA
Indica III	913	55.90%	43.80%	0.11%	0.22%	NA
Indica Intermediate	786	64.40%	35.50%	0.13%	0.00%	NA
Temperate Japonica	767	99.90%	0.00%	0.13%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	90.00%	10.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1201093266	C -> DEL	N	N	silent_mutation	Average:56.467; most accessible tissue: Callus, score: 74.37	N	N	N	N
vg1201093266	C -> A	LOC_Os12g02930.1	upstream_gene_variant ; 3425.0bp to feature; MODIFIER	silent_mutation	Average:56.467; most accessible tissue: Callus, score: 74.37	N	N	N	N
vg1201093266	C -> A	LOC_Os12g02940.1	upstream_gene_variant ; 282.0bp to feature; MODIFIER	silent_mutation	Average:56.467; most accessible tissue: Callus, score: 74.37	N	N	N	N
vg1201093266	C -> A	LOC_Os12g02960.1	upstream_gene_variant ; 4210.0bp to feature; MODIFIER	silent_mutation	Average:56.467; most accessible tissue: Callus, score: 74.37	N	N	N	N
vg1201093266	C -> A	LOC_Os12g02950.1	downstream_gene_variant ; 472.0bp to feature; MODIFIER	silent_mutation	Average:56.467; most accessible tissue: Callus, score: 74.37	N	N	N	N
vg1201093266	C -> A	LOC_Os12g02940-LOC_Os12g02950	intergenic_region ; MODIFIER	silent_mutation	Average:56.467; most accessible tissue: Callus, score: 74.37	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1201093266	NA	3.19E-06	mr1028	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201093266	NA	1.38E-06	mr1038	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201093266	NA	9.00E-06	mr1209	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201093266	NA	1.00E-06	mr1280	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201093266	NA	5.57E-06	mr1367	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201093266	NA	2.54E-09	mr1442	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201093266	NA	2.92E-06	mr1461	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201093266	NA	5.63E-07	mr1498	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201093266	NA	3.67E-07	mr1545	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201093266	NA	2.68E-08	mr1574	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201093266	NA	1.08E-07	mr1634	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201093266	NA	7.01E-06	mr1634	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201093266	NA	1.81E-06	mr1651	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201093266	NA	1.96E-06	mr1735	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201093266	NA	4.17E-06	mr1820	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201093266	NA	7.21E-11	mr1921	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201093266	NA	4.63E-06	mr1948	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251