\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1201093266:

Variant ID: vg1201093266 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 1093266
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, A: 0.06, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


TACACAAAGGAAATAGGAGACAACAGCGAATACGATTCCATCTCAACTAATCCTGTCATAGAGATTGACAGATCAATCGGCTGGCTCAGCGAGCTACTCC[C/A]
TCCGTTTCAAAATGTTTGACACCATTGACTTTTTAGCACATATTTGACTGTTCGTCTTATTAAAAAAATTGTGAAATATGTAAAACTATATGTGTACATC

Reverse complement sequence

GATGTACACATATAGTTTTACATATTTCACAATTTTTTTAATAAGACGAACAGTCAAATATGTGCTAAAAAGTCAATGGTGTCAAACATTTTGAAACGGA[G/T]
GGAGTAGCTCGCTGAGCCAGCCGATTGATCTGTCAATCTCTATGACAGGATTAGTTGAGATGGAATCGTATTCGCTGTTGTCTCCTATTTCCTTTGTGTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.20% 26.60% 0.08% 0.06% NA
All Indica  2759 64.30% 35.50% 0.07% 0.11% NA
All Japonica  1512 99.70% 0.30% 0.07% 0.00% NA
Aus  269 1.90% 97.80% 0.37% 0.00% NA
Indica I  595 56.30% 43.70% 0.00% 0.00% NA
Indica II  465 91.20% 8.60% 0.00% 0.22% NA
Indica III  913 55.90% 43.80% 0.11% 0.22% NA
Indica Intermediate  786 64.40% 35.50% 0.13% 0.00% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1201093266 C -> DEL N N silent_mutation Average:56.467; most accessible tissue: Callus, score: 74.37 N N N N
vg1201093266 C -> A LOC_Os12g02930.1 upstream_gene_variant ; 3425.0bp to feature; MODIFIER silent_mutation Average:56.467; most accessible tissue: Callus, score: 74.37 N N N N
vg1201093266 C -> A LOC_Os12g02940.1 upstream_gene_variant ; 282.0bp to feature; MODIFIER silent_mutation Average:56.467; most accessible tissue: Callus, score: 74.37 N N N N
vg1201093266 C -> A LOC_Os12g02960.1 upstream_gene_variant ; 4210.0bp to feature; MODIFIER silent_mutation Average:56.467; most accessible tissue: Callus, score: 74.37 N N N N
vg1201093266 C -> A LOC_Os12g02950.1 downstream_gene_variant ; 472.0bp to feature; MODIFIER silent_mutation Average:56.467; most accessible tissue: Callus, score: 74.37 N N N N
vg1201093266 C -> A LOC_Os12g02940-LOC_Os12g02950 intergenic_region ; MODIFIER silent_mutation Average:56.467; most accessible tissue: Callus, score: 74.37 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1201093266 NA 3.19E-06 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201093266 NA 1.38E-06 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201093266 NA 9.00E-06 mr1209 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201093266 NA 1.00E-06 mr1280 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201093266 NA 5.57E-06 mr1367 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201093266 NA 2.54E-09 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201093266 NA 2.92E-06 mr1461 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201093266 NA 5.63E-07 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201093266 NA 3.67E-07 mr1545 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201093266 NA 2.68E-08 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201093266 NA 1.08E-07 mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201093266 NA 7.01E-06 mr1634 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201093266 NA 1.81E-06 mr1651 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201093266 NA 1.96E-06 mr1735 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201093266 NA 4.17E-06 mr1820 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201093266 NA 7.21E-11 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201093266 NA 4.63E-06 mr1948 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251