Variant ID: vg1201066168 (JBrowse) | Variation Type: SNP |
Chromosome: chr12 | Position: 1066168 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GAAAGAGCAGTCAAAGGTGACGCCCACCACATGCTCGACGAAATGCTCTAGTCCCGACATTGAGCCAATCTCACCGTGGTTGCGGTGGACAAATGTGCCA[C/T]
CACTCCCATGGCCTCCATGAAGTTGGTAGCTGATGATGGTGCAACTAGCACCACCAAAATTGCCACCACTGACTATTCCAAGGATACGCACGGCAAGTGT
ACACTTGCCGTGCGTATCCTTGGAATAGTCAGTGGTGGCAATTTTGGTGGTGCTAGTTGCACCATCATCAGCTACCAACTTCATGGAGGCCATGGGAGTG[G/A]
TGGCACATTTGTCCACCGCAACCACGGTGAGATTGGCTCAATGTCGGGACTAGAGCATTTCGTCGAGCATGTGGTGGGCGTCACCTTTGACTGCTCTTTC
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 96.70% | 2.00% | 1.29% | 0.00% | NA |
All Indica | 2759 | 94.30% | 3.40% | 2.21% | 0.00% | NA |
All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 81.70% | 11.40% | 6.89% | 0.00% | NA |
Indica II | 465 | 97.40% | 1.30% | 1.29% | 0.00% | NA |
Indica III | 913 | 99.90% | 0.00% | 0.11% | 0.00% | NA |
Indica Intermediate | 786 | 95.70% | 2.70% | 1.65% | 0.00% | NA |
Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1201066168 | C -> T | LOC_Os12g02890.1 | downstream_gene_variant ; 4895.0bp to feature; MODIFIER | silent_mutation | Average:37.58; most accessible tissue: Zhenshan97 flower, score: 52.192 | N | N | N | N |
vg1201066168 | C -> T | LOC_Os12g02910.1 | downstream_gene_variant ; 3806.0bp to feature; MODIFIER | silent_mutation | Average:37.58; most accessible tissue: Zhenshan97 flower, score: 52.192 | N | N | N | N |
vg1201066168 | C -> T | LOC_Os12g02900.1 | intron_variant ; MODIFIER | silent_mutation | Average:37.58; most accessible tissue: Zhenshan97 flower, score: 52.192 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1201066168 | 1.76E-07 | 5.06E-13 | mr1038 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1201066168 | 8.78E-07 | 6.85E-12 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1201066168 | 2.72E-09 | 2.65E-17 | mr1389 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1201066168 | 6.03E-08 | 4.00E-14 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1201066168 | 2.00E-06 | 1.19E-15 | mr1038_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1201066168 | 6.29E-06 | 2.32E-13 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1201066168 | 8.22E-06 | 2.19E-14 | mr1389_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1201066168 | NA | 1.21E-12 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |