\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1201066168:

Variant ID: vg1201066168 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 1066168
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAAAGAGCAGTCAAAGGTGACGCCCACCACATGCTCGACGAAATGCTCTAGTCCCGACATTGAGCCAATCTCACCGTGGTTGCGGTGGACAAATGTGCCA[C/T]
CACTCCCATGGCCTCCATGAAGTTGGTAGCTGATGATGGTGCAACTAGCACCACCAAAATTGCCACCACTGACTATTCCAAGGATACGCACGGCAAGTGT

Reverse complement sequence

ACACTTGCCGTGCGTATCCTTGGAATAGTCAGTGGTGGCAATTTTGGTGGTGCTAGTTGCACCATCATCAGCTACCAACTTCATGGAGGCCATGGGAGTG[G/A]
TGGCACATTTGTCCACCGCAACCACGGTGAGATTGGCTCAATGTCGGGACTAGAGCATTTCGTCGAGCATGTGGTGGGCGTCACCTTTGACTGCTCTTTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.70% 2.00% 1.29% 0.00% NA
All Indica  2759 94.30% 3.40% 2.21% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 81.70% 11.40% 6.89% 0.00% NA
Indica II  465 97.40% 1.30% 1.29% 0.00% NA
Indica III  913 99.90% 0.00% 0.11% 0.00% NA
Indica Intermediate  786 95.70% 2.70% 1.65% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1201066168 C -> T LOC_Os12g02890.1 downstream_gene_variant ; 4895.0bp to feature; MODIFIER silent_mutation Average:37.58; most accessible tissue: Zhenshan97 flower, score: 52.192 N N N N
vg1201066168 C -> T LOC_Os12g02910.1 downstream_gene_variant ; 3806.0bp to feature; MODIFIER silent_mutation Average:37.58; most accessible tissue: Zhenshan97 flower, score: 52.192 N N N N
vg1201066168 C -> T LOC_Os12g02900.1 intron_variant ; MODIFIER silent_mutation Average:37.58; most accessible tissue: Zhenshan97 flower, score: 52.192 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1201066168 1.76E-07 5.06E-13 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201066168 8.78E-07 6.85E-12 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201066168 2.72E-09 2.65E-17 mr1389 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201066168 6.03E-08 4.00E-14 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201066168 2.00E-06 1.19E-15 mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201066168 6.29E-06 2.32E-13 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201066168 8.22E-06 2.19E-14 mr1389_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201066168 NA 1.21E-12 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251