Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1200875101:

Variant ID: vg1200875101 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 875101
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.80, G: 0.20, others allele: 0.00, population size: 173. )

Flanking Sequence (100 bp) in Reference Genome:


ACCACCTTCAAAAATTACCTGACACAAAACACAAAAACTACCAGCACAATCAAGTAATTATACATTCAGTTCAGTTCAGCCATACATTCTTATCTCCCAT[T/G]
ACACAAAACACTCCCTCTCTAGCCAGCTGCTGGTTTCTCCAGCCAAACAAGAGGCTTGGCACACTTGTTTTCCCTAGGTCCCTAAGCATTTTGTTTGATC

Reverse complement sequence

GATCAAACAAAATGCTTAGGGACCTAGGGAAAACAAGTGTGCCAAGCCTCTTGTTTGGCTGGAGAAACCAGCAGCTGGCTAGAGAGGGAGTGTTTTGTGT[A/C]
ATGGGAGATAAGAATGTATGGCTGAACTGAACTGAATGTATAATTACTTGATTGTGCTGGTAGTTTTTGTGTTTTGTGTCAGGTAATTTTTGAAGGTGGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.70% 39.30% 0.04% 0.00% NA
All Indica  2759 90.60% 9.40% 0.04% 0.00% NA
All Japonica  1512 4.30% 95.70% 0.00% 0.00% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 69.70% 30.30% 0.00% 0.00% NA
Indica II  465 96.60% 3.40% 0.00% 0.00% NA
Indica III  913 98.20% 1.80% 0.00% 0.00% NA
Indica Intermediate  786 94.00% 5.90% 0.13% 0.00% NA
Temperate Japonica  767 5.60% 94.40% 0.00% 0.00% NA
Tropical Japonica  504 3.40% 96.60% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 6.20% 93.80% 0.00% 0.00% NA
Intermediate  90 35.60% 63.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1200875101 T -> G LOC_Os12g02550.1 downstream_gene_variant ; 1192.0bp to feature; MODIFIER silent_mutation Average:47.536; most accessible tissue: Zhenshan97 root, score: 78.63 N N N N
vg1200875101 T -> G LOC_Os12g02540-LOC_Os12g02550 intergenic_region ; MODIFIER silent_mutation Average:47.536; most accessible tissue: Zhenshan97 root, score: 78.63 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1200875101 NA 3.32E-11 mr1084 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200875101 NA 3.87E-06 mr1184 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200875101 NA 4.37E-06 mr1209 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200875101 NA 1.60E-07 mr1278 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200875101 NA 5.54E-09 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200875101 NA 2.17E-14 mr1376 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200875101 NA 7.98E-07 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200875101 NA 2.17E-14 mr1431 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200875101 NA 4.14E-08 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200875101 NA 3.43E-12 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200875101 NA 8.75E-09 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200875101 NA 9.60E-14 mr1636 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200875101 NA 2.82E-14 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200875101 NA 3.70E-11 mr1751 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200875101 NA 3.45E-20 mr1767 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200875101 NA 2.05E-08 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200875101 NA 9.81E-08 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200875101 NA 2.20E-24 mr1838 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200875101 NA 1.12E-24 mr1839 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200875101 NA 8.40E-08 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200875101 NA 2.50E-17 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200875101 NA 5.14E-13 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200875101 NA 4.58E-06 mr1960 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200875101 NA 1.13E-07 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251