\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1200851947:

Variant ID: vg1200851947 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 851947
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.02, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


GACAGTGGCTTTTGTAGGCGACAGGCGAGGAGGAGGTAGCTAAGGAGGAGGCCAAGCGGAGCTCGCAAAGGAGAAGGAAGGCGTGTCAGAGGCCGAATCA[G/A]
AACTTCAGTGGTCCAGCCTCTTCGCGCGTTGCACTGCCCGCCACTACTGAGCCACGGGCGACACGCTTGCCTGTCTGCTTCTAGCCCGTGCACGAGGAGC

Reverse complement sequence

GCTCCTCGTGCACGGGCTAGAAGCAGACAGGCAAGCGTGTCGCCCGTGGCTCAGTAGTGGCGGGCAGTGCAACGCGCGAAGAGGCTGGACCACTGAAGTT[C/T]
TGATTCGGCCTCTGACACGCCTTCCTTCTCCTTTGCGAGCTCCGCTTGGCCTCCTCCTTAGCTACCTCCTCCTCGCCTGTCGCCTACAAAAGCCACTGTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.60% 30.30% 0.15% 0.00% NA
All Indica  2759 50.50% 49.30% 0.25% 0.00% NA
All Japonica  1512 96.70% 3.30% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 75.00% 24.90% 0.17% 0.00% NA
Indica II  465 12.50% 87.30% 0.22% 0.00% NA
Indica III  913 55.10% 44.90% 0.00% 0.00% NA
Indica Intermediate  786 49.10% 50.30% 0.64% 0.00% NA
Temperate Japonica  767 95.20% 4.80% 0.00% 0.00% NA
Tropical Japonica  504 98.00% 2.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 78.90% 21.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1200851947 G -> A LOC_Os12g02490.1 upstream_gene_variant ; 3658.0bp to feature; MODIFIER silent_mutation Average:80.66; most accessible tissue: Minghui63 panicle, score: 88.281 N N N N
vg1200851947 G -> A LOC_Os12g02500.1 upstream_gene_variant ; 2058.0bp to feature; MODIFIER silent_mutation Average:80.66; most accessible tissue: Minghui63 panicle, score: 88.281 N N N N
vg1200851947 G -> A LOC_Os12g02510.1 upstream_gene_variant ; 4238.0bp to feature; MODIFIER silent_mutation Average:80.66; most accessible tissue: Minghui63 panicle, score: 88.281 N N N N
vg1200851947 G -> A LOC_Os12g02490-LOC_Os12g02500 intergenic_region ; MODIFIER silent_mutation Average:80.66; most accessible tissue: Minghui63 panicle, score: 88.281 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1200851947 G A -0.01 -0.02 -0.02 -0.02 -0.02 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1200851947 NA 3.58E-22 Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1200851947 NA 2.89E-15 Plant_height Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1200851947 NA 1.13E-12 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200851947 NA 1.59E-07 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200851947 NA 6.54E-07 mr1944 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200851947 NA 5.47E-13 mr1330_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200851947 4.15E-06 NA mr1383_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251