Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1200437573:

Variant ID: vg1200437573 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 437573
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

TCTCCCTCGCCGGTCACAACATGACCGTCGTCGCCGCCGACGCCTCCTACACCAAACCGTACACCACCTCCCTCCTCCTCCTCGCCCCCGGCCAGACCAC[C/T]
GACGTCCTCGTCACCTTCGACCAACCTCCCGGCCGCTACTACCTCGCCGCCCGCGCCTACGCCAGCGCCCAGGGCGTCCCCTTCGACAACACCACCACCA

Reverse complement sequence

TGGTGGTGGTGTTGTCGAAGGGGACGCCCTGGGCGCTGGCGTAGGCGCGGGCGGCGAGGTAGTAGCGGCCGGGAGGTTGGTCGAAGGTGACGAGGACGTC[G/A]
GTGGTCTGGCCGGGGGCGAGGAGGAGGAGGGAGGTGGTGTACGGTTTGGTGTAGGAGGCGTCGGCGGCGACGACGGTCATGTTGTGACCGGCGAGGGAGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.90%	35.80%	0.28%	0.00%	NA
All Indica	2759	78.70%	21.20%	0.18%	0.00%	NA
All Japonica	1512	43.50%	56.20%	0.33%	0.00%	NA
Aus	269	51.30%	48.00%	0.74%	0.00%	NA
Indica I	595	64.40%	35.10%	0.50%	0.00%	NA
Indica II	465	84.10%	15.90%	0.00%	0.00%	NA
Indica III	913	82.60%	17.40%	0.00%	0.00%	NA
Indica Intermediate	786	81.70%	18.10%	0.25%	0.00%	NA
Temperate Japonica	767	71.10%	28.30%	0.65%	0.00%	NA
Tropical Japonica	504	6.70%	93.30%	0.00%	0.00%	NA
Japonica Intermediate	241	32.40%	67.60%	0.00%	0.00%	NA
VI/Aromatic	96	8.30%	90.60%	1.04%	0.00%	NA
Intermediate	90	52.20%	47.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1200437573	C -> T	LOC_Os12g01730.1	synonymous_variant ; p.Thr268Thr; LOW	synonymous_codon	Average:57.383; most accessible tissue: Minghui63 root, score: 73.73	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1200437573	NA	2.62E-10	Heading_date	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1200437573	NA	1.02E-16	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1200437573	NA	1.64E-14	Spikelet_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1200437573	9.65E-06	1.02E-07	mr1070	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200437573	NA	6.94E-07	mr1097	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200437573	7.31E-06	7.31E-06	mr1128	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200437573	NA	1.11E-06	mr1154	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200437573	NA	1.89E-06	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200437573	NA	3.70E-06	mr1503	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200437573	NA	1.63E-06	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200437573	NA	6.79E-06	mr1596	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200437573	4.97E-06	4.97E-06	mr1935	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200437573	NA	1.89E-06	mr1063_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200437573	4.16E-06	4.16E-06	mr1074_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200437573	NA	4.40E-07	mr1092_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200437573	NA	5.67E-08	mr1097_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200437573	NA	1.14E-06	mr1128_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200437573	NA	2.96E-06	mr1152_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200437573	NA	1.01E-06	mr1154_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200437573	NA	1.09E-06	mr1183_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200437573	NA	4.14E-07	mr1204_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200437573	NA	6.84E-07	mr1206_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200437573	NA	1.10E-07	mr1229_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200437573	NA	1.32E-06	mr1252_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200437573	NA	7.77E-06	mr1263_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200437573	NA	1.73E-06	mr1359_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200437573	NA	2.61E-06	mr1596_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200437573	NA	1.09E-07	mr1794_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200437573	NA	2.25E-09	mr1825_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200437573	NA	8.31E-07	mr1865_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200437573	NA	1.07E-07	mr1880_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200437573	NA	5.83E-06	mr1896_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251