Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1128772910:

Variant ID: vg1128772910 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 28772910
Reference Allele: G	Alternative Allele: A,T
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:

GGAGTTATATGGAGGGCTAGGCATATAGCAGTTTTGGTGGGATAGAGATTGAGAGAACTTCCTACTTTTCAATATCTGGAGGGAACTGCTCCTTTACGTT[G/A,T]
CCTAAACAATACTTAGCCCTCTCTTTTCTAAGCAAAACTTAATCTCTATCTAAAGTCTGTGTCGATTCCCACCATCTTTACAAATAAAAGATTAAAAAAT

Reverse complement sequence

ATTTTTTAATCTTTTATTTGTAAAGATGGTGGGAATCGACACAGACTTTAGATAGAGATTAAGTTTTGCTTAGAAAAGAGAGGGCTAAGTATTGTTTAGG[C/T,A]
AACGTAAAGGAGCAGTTCCCTCCAGATATTGAAAAGTAGGAAGTTCTCTCAATCTCTATCCCACCAAAACTGCTATATGCCTAGCCCTCCATATAACTCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.50%	25.50%	0.00%	0.00%	T: 0.04%
All Indica	2759	59.00%	41.00%	0.00%	0.00%	T: 0.07%
All Japonica	1512	97.00%	3.00%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	39.50%	60.50%	0.00%	0.00%	NA
Indica II	465	83.70%	16.30%	0.00%	0.00%	NA
Indica III	913	47.40%	52.40%	0.00%	0.00%	T: 0.22%
Indica Intermediate	786	72.50%	27.50%	0.00%	0.00%	NA
Temperate Japonica	767	95.40%	4.60%	0.00%	0.00%	NA
Tropical Japonica	504	98.40%	1.60%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	68.90%	31.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1128772910	G -> T	LOC_Os11g47650.1	upstream_gene_variant ; 1525.0bp to feature; MODIFIER	silent_mutation	Average:59.226; most accessible tissue: Zhenshan97 root, score: 80.68	N	N	N	N
vg1128772910	G -> T	LOC_Os11g47650.2	upstream_gene_variant ; 1525.0bp to feature; MODIFIER	silent_mutation	Average:59.226; most accessible tissue: Zhenshan97 root, score: 80.68	N	N	N	N
vg1128772910	G -> T	LOC_Os11g47640.1	intron_variant ; MODIFIER	silent_mutation	Average:59.226; most accessible tissue: Zhenshan97 root, score: 80.68	N	N	N	N
vg1128772910	G -> A	LOC_Os11g47650.1	upstream_gene_variant ; 1525.0bp to feature; MODIFIER	silent_mutation	Average:59.226; most accessible tissue: Zhenshan97 root, score: 80.68	N	N	N	N
vg1128772910	G -> A	LOC_Os11g47650.2	upstream_gene_variant ; 1525.0bp to feature; MODIFIER	silent_mutation	Average:59.226; most accessible tissue: Zhenshan97 root, score: 80.68	N	N	N	N
vg1128772910	G -> A	LOC_Os11g47640.1	intron_variant ; MODIFIER	silent_mutation	Average:59.226; most accessible tissue: Zhenshan97 root, score: 80.68	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1128772910	NA	9.42E-06	mr1644	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128772910	5.67E-06	8.72E-09	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128772910	6.19E-07	2.69E-11	mr1662	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128772910	NA	1.56E-15	mr1191_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128772910	NA	1.43E-09	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128772910	NA	1.03E-07	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128772910	NA	9.65E-09	mr1662_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128772910	NA	8.71E-06	mr1959_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251