Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1128648694:

Variant ID: vg1128648694 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 28648694
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 191. )

Flanking Sequence (100 bp) in Reference Genome:

ATGCTTGCCACGAGGTATACACACTTGATGGCCCGTCAGCCAGCATTTTAATTGTTCTTTCTTCCATGGTATGGCCATCTGGTAGATCGAGGTACTTGAA[C/T]
CATTCAGTAAAGTGATGCTTGTGTTTCTTCATGATCCATGCATTAGATCGCCCCACATTTGTTGCTTGTAATTCATGCAGGTGTTGCTCTATGTACGGCT

Reverse complement sequence

AGCCGTACATAGAGCAACACCTGCATGAATTACAAGCAACAAATGTGGGGCGATCTAATGCATGGATCATGAAGAAACACAAGCATCACTTTACTGAATG[G/A]
TTCAAGTACCTCGATCTACCAGATGGCCATACCATGGAAGAAAGAACAATTAAAATGCTGGCTGACGGGCCATCAAGTGTGTATACCTCGTGGCAAGCAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.00%	6.00%	1.78%	16.17%	NA
All Indica	2759	72.60%	0.60%	2.32%	24.54%	NA
All Japonica	1512	81.50%	13.20%	1.06%	4.23%	NA
Aus	269	72.90%	23.00%	1.12%	2.97%	NA
Indica I	595	81.80%	0.30%	1.01%	16.81%	NA
Indica II	465	64.90%	0.20%	3.66%	31.18%	NA
Indica III	913	70.00%	0.00%	2.74%	27.27%	NA
Indica Intermediate	786	73.00%	1.70%	2.04%	23.28%	NA
Temperate Japonica	767	89.20%	5.60%	1.83%	3.39%	NA
Tropical Japonica	504	73.20%	23.00%	0.40%	3.37%	NA
Japonica Intermediate	241	74.70%	16.60%	0.00%	8.71%	NA
VI/Aromatic	96	93.80%	0.00%	0.00%	6.25%	NA
Intermediate	90	81.10%	7.80%	1.11%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1128648694	C -> T	LOC_Os11g47446.1	stop_gained ; p.Trp352*; HIGH	stop_gained	Average:38.445; most accessible tissue: Minghui63 young leaf, score: 58.21	N	N	N	N
vg1128648694	C -> DEL	LOC_Os11g47446.1	N	frameshift_variant	Average:38.445; most accessible tissue: Minghui63 young leaf, score: 58.21	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1128648694	NA	5.66E-06	mr1076	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128648694	NA	3.20E-06	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128648694	NA	1.67E-08	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128648694	7.76E-06	7.76E-06	mr1145	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128648694	NA	2.63E-06	mr1159	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128648694	NA	6.36E-07	mr1283	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128648694	5.06E-07	2.96E-12	mr1299	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128648694	1.67E-06	1.67E-06	mr1299	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128648694	NA	3.46E-07	mr1304	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128648694	3.68E-06	NA	mr1307	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128648694	4.87E-06	7.15E-10	mr1345	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128648694	NA	2.61E-06	mr1408	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128648694	1.44E-08	4.30E-11	mr1427	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128648694	NA	1.73E-06	mr1427	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128648694	1.88E-06	NA	mr1560	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128648694	NA	5.69E-08	mr1560	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128648694	NA	2.39E-07	mr1634	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128648694	NA	1.93E-07	mr1639	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128648694	NA	1.95E-06	mr1661	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128648694	NA	1.04E-06	mr1700	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128648694	NA	1.63E-06	mr1727	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128648694	NA	3.25E-08	mr1756	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128648694	4.20E-06	4.20E-06	mr1791	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128648694	6.50E-06	6.52E-06	mr1823	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128648694	NA	2.66E-06	mr1852	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251