\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1128648694:

Variant ID: vg1128648694 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 28648694
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 191. )

Flanking Sequence (100 bp) in Reference Genome:


ATGCTTGCCACGAGGTATACACACTTGATGGCCCGTCAGCCAGCATTTTAATTGTTCTTTCTTCCATGGTATGGCCATCTGGTAGATCGAGGTACTTGAA[C/T]
CATTCAGTAAAGTGATGCTTGTGTTTCTTCATGATCCATGCATTAGATCGCCCCACATTTGTTGCTTGTAATTCATGCAGGTGTTGCTCTATGTACGGCT

Reverse complement sequence

AGCCGTACATAGAGCAACACCTGCATGAATTACAAGCAACAAATGTGGGGCGATCTAATGCATGGATCATGAAGAAACACAAGCATCACTTTACTGAATG[G/A]
TTCAAGTACCTCGATCTACCAGATGGCCATACCATGGAAGAAAGAACAATTAAAATGCTGGCTGACGGGCCATCAAGTGTGTATACCTCGTGGCAAGCAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.00% 6.00% 1.78% 16.17% NA
All Indica  2759 72.60% 0.60% 2.32% 24.54% NA
All Japonica  1512 81.50% 13.20% 1.06% 4.23% NA
Aus  269 72.90% 23.00% 1.12% 2.97% NA
Indica I  595 81.80% 0.30% 1.01% 16.81% NA
Indica II  465 64.90% 0.20% 3.66% 31.18% NA
Indica III  913 70.00% 0.00% 2.74% 27.27% NA
Indica Intermediate  786 73.00% 1.70% 2.04% 23.28% NA
Temperate Japonica  767 89.20% 5.60% 1.83% 3.39% NA
Tropical Japonica  504 73.20% 23.00% 0.40% 3.37% NA
Japonica Intermediate  241 74.70% 16.60% 0.00% 8.71% NA
VI/Aromatic  96 93.80% 0.00% 0.00% 6.25% NA
Intermediate  90 81.10% 7.80% 1.11% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1128648694 C -> T LOC_Os11g47446.1 stop_gained ; p.Trp352*; HIGH stop_gained Average:38.445; most accessible tissue: Minghui63 young leaf, score: 58.21 N N N N
vg1128648694 C -> DEL LOC_Os11g47446.1 N frameshift_variant Average:38.445; most accessible tissue: Minghui63 young leaf, score: 58.21 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1128648694 NA 5.66E-06 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128648694 NA 3.20E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128648694 NA 1.67E-08 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128648694 7.76E-06 7.76E-06 mr1145 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128648694 NA 2.63E-06 mr1159 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128648694 NA 6.36E-07 mr1283 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128648694 5.06E-07 2.96E-12 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128648694 1.67E-06 1.67E-06 mr1299 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128648694 NA 3.46E-07 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128648694 3.68E-06 NA mr1307 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128648694 4.87E-06 7.15E-10 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128648694 NA 2.61E-06 mr1408 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128648694 1.44E-08 4.30E-11 mr1427 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128648694 NA 1.73E-06 mr1427 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128648694 1.88E-06 NA mr1560 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128648694 NA 5.69E-08 mr1560 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128648694 NA 2.39E-07 mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128648694 NA 1.93E-07 mr1639 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128648694 NA 1.95E-06 mr1661 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128648694 NA 1.04E-06 mr1700 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128648694 NA 1.63E-06 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128648694 NA 3.25E-08 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128648694 4.20E-06 4.20E-06 mr1791 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128648694 6.50E-06 6.52E-06 mr1823 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128648694 NA 2.66E-06 mr1852 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251