\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1128595453:

Variant ID: vg1128595453 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 28595453
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAAATGTGTTGCAATTAAATCTTTAAAACAAGACCACACATGGATATATTCCGATGAAAAAAAAAACTTATTATTGAGTTATTTTTAAATGTTGCACGCT[A/G]
TTTCACCAAGTATATCGGAATTGTTTCACTGAGTAGATCGAAAATGTTCAAACCACCACGTCGACAGCAGCTAGATAGGCTACTCCAAATATTGTACTGG

Reverse complement sequence

CCAGTACAATATTTGGAGTAGCCTATCTAGCTGCTGTCGACGTGGTGGTTTGAACATTTTCGATCTACTCAGTGAAACAATTCCGATATACTTGGTGAAA[T/C]
AGCGTGCAACATTTAAAAATAACTCAATAATAAGTTTTTTTTTTCATCGGAATATATCCATGTGTGGTCTTGTTTTAAAGATTTAATTGCAACACATTTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.20% 5.90% 0.30% 36.61% NA
All Indica  2759 45.80% 0.50% 0.36% 53.28% NA
All Japonica  1512 80.90% 12.80% 0.07% 6.28% NA
Aus  269 24.50% 23.00% 0.37% 52.04% NA
Indica I  595 64.20% 0.30% 0.34% 35.13% NA
Indica II  465 31.80% 0.20% 0.86% 67.10% NA
Indica III  913 42.10% 0.00% 0.22% 57.72% NA
Indica Intermediate  786 44.50% 1.50% 0.25% 53.69% NA
Temperate Japonica  767 87.60% 4.20% 0.13% 8.08% NA
Tropical Japonica  504 74.00% 23.20% 0.00% 2.78% NA
Japonica Intermediate  241 73.90% 18.30% 0.00% 7.88% NA
VI/Aromatic  96 89.60% 0.00% 2.08% 8.33% NA
Intermediate  90 73.30% 7.80% 0.00% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1128595453 A -> DEL N N silent_mutation Average:42.256; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg1128595453 A -> G LOC_Os11g47438.1 upstream_gene_variant ; 3960.0bp to feature; MODIFIER silent_mutation Average:42.256; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg1128595453 A -> G LOC_Os11g47438-LOC_Os11g47439 intergenic_region ; MODIFIER silent_mutation Average:42.256; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1128595453 A G 0.02 0.01 0.01 0.01 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1128595453 8.86E-06 NA mr1076 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128595453 NA 7.57E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128595453 2.33E-10 NA mr1083 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128595453 NA 2.38E-08 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128595453 1.21E-06 NA mr1085 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128595453 1.06E-06 NA mr1226 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128595453 2.37E-06 6.00E-07 mr1227 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128595453 NA 9.67E-06 mr1227 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128595453 4.09E-08 3.68E-13 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128595453 1.48E-07 1.48E-07 mr1299 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128595453 NA 8.40E-07 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128595453 2.33E-06 4.24E-10 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128595453 NA 1.28E-06 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128595453 6.98E-06 NA mr1411 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128595453 1.93E-08 5.57E-11 mr1427 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128595453 NA 2.69E-06 mr1427 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128595453 3.36E-07 NA mr1560 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128595453 NA 9.36E-08 mr1560 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128595453 3.78E-06 3.78E-06 mr1605 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128595453 NA 1.72E-06 mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128595453 8.54E-06 3.05E-08 mr1639 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128595453 NA 1.37E-06 mr1661 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128595453 3.90E-06 NA mr1700 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128595453 NA 2.38E-07 mr1700 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128595453 NA 5.74E-07 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128595453 NA 1.60E-08 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128595453 NA 2.27E-06 mr1852 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251