\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1128473972:

Variant ID: vg1128473972 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 28473972
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, G: 0.01, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


AGAAAAACAAAACTGAACACTGCAGTAGAGCAGAGGACCAACAGCAACACAAGAGAAAAGAAGTCATCACATCTACCTGCTACCTAACTGGAGCACAACA[A/G]
GGCTACCAGCAAGCAGGCAGATTGTGCAACTGCCATCTACTCACCGAACACCAAACTCTCCCTCTCGCTTCTCTTGCAAAACAACCTTTCCAGAACCAAA

Reverse complement sequence

TTTGGTTCTGGAAAGGTTGTTTTGCAAGAGAAGCGAGAGGGAGAGTTTGGTGTTCGGTGAGTAGATGGCAGTTGCACAATCTGCCTGCTTGCTGGTAGCC[T/C]
TGTTGTGCTCCAGTTAGGTAGCAGGTAGATGTGATGACTTCTTTTCTCTTGTGTTGCTGTTGGTCCTCTGCTCTACTGCAGTGTTCAGTTTTGTTTTTCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.90% 24.40% 2.33% 22.39% NA
All Indica  2759 54.50% 22.10% 1.05% 22.29% NA
All Japonica  1512 42.80% 32.20% 4.76% 20.24% NA
Aus  269 63.60% 15.20% 2.60% 18.59% NA
Indica I  595 74.50% 2.90% 0.17% 22.52% NA
Indica II  465 13.30% 64.10% 1.72% 20.86% NA
Indica III  913 65.50% 8.90% 1.64% 23.99% NA
Indica Intermediate  786 51.10% 27.20% 0.64% 20.99% NA
Temperate Japonica  767 41.20% 35.10% 6.52% 17.21% NA
Tropical Japonica  504 41.50% 29.80% 2.58% 26.19% NA
Japonica Intermediate  241 50.60% 28.20% 3.73% 17.43% NA
VI/Aromatic  96 32.30% 2.10% 1.04% 64.58% NA
Intermediate  90 56.70% 14.40% 1.11% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1128473972 A -> DEL N N silent_mutation Average:47.275; most accessible tissue: Zhenshan97 panicle, score: 93.845 N N N N
vg1128473972 A -> G LOC_Os11g47320.1 upstream_gene_variant ; 4160.0bp to feature; MODIFIER silent_mutation Average:47.275; most accessible tissue: Zhenshan97 panicle, score: 93.845 N N N N
vg1128473972 A -> G LOC_Os11g47330.1 upstream_gene_variant ; 489.0bp to feature; MODIFIER silent_mutation Average:47.275; most accessible tissue: Zhenshan97 panicle, score: 93.845 N N N N
vg1128473972 A -> G LOC_Os11g47320.2 upstream_gene_variant ; 4160.0bp to feature; MODIFIER silent_mutation Average:47.275; most accessible tissue: Zhenshan97 panicle, score: 93.845 N N N N
vg1128473972 A -> G LOC_Os11g47320-LOC_Os11g47330 intergenic_region ; MODIFIER silent_mutation Average:47.275; most accessible tissue: Zhenshan97 panicle, score: 93.845 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1128473972 A G 0.05 0.09 0.07 0.06 0.06 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1128473972 NA 1.45E-06 mr1032 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128473972 NA 6.31E-06 mr1165 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128473972 NA 4.83E-07 mr1478 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128473972 9.10E-07 4.81E-07 mr1755 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128473972 NA 3.84E-07 mr1755 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128473972 NA 8.05E-08 mr1942 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128473972 NA 6.44E-07 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128473972 NA 2.52E-06 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128473972 NA 8.45E-06 mr1319_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128473972 NA 4.10E-06 mr1332_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128473972 NA 5.08E-08 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128473972 NA 6.82E-09 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128473972 NA 4.40E-06 mr1838_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128473972 NA 3.19E-06 mr1931_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128473972 NA 2.59E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251