\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1128445952:

Variant ID: vg1128445952 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 28445952
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCTAACTAATCTGCGTTGGATCAATTTTGCAGACAACCAACTCAGCAAACCAATACTGCCAGCTTCCCTCATGACGTTGGAGAATCTGCTGGGATTTGAT[C/G]
TCTCCAAGAATAGTATAGCTGGTCCAATCCCCAAAGAAATTAGTATGCTGACAAGACTTGTATGCTTGTTCCTCAGCGATAATAAACTCTCAGGTTCAAT

Reverse complement sequence

ATTGAACCTGAGAGTTTATTATCGCTGAGGAACAAGCATACAAGTCTTGTCAGCATACTAATTTCTTTGGGGATTGGACCAGCTATACTATTCTTGGAGA[G/C]
ATCAAATCCCAGCAGATTCTCCAACGTCATGAGGGAAGCTGGCAGTATTGGTTTGCTGAGTTGGTTGTCTGCAAAATTGATCCAACGCAGATTAGTTAGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.60% 2.80% 1.57% 39.06% NA
All Indica  2759 57.20% 1.10% 1.78% 39.94% NA
All Japonica  1512 55.20% 6.50% 1.39% 36.97% NA
Aus  269 68.40% 0.00% 0.37% 31.23% NA
Indica I  595 73.80% 0.20% 1.85% 24.20% NA
Indica II  465 27.50% 0.40% 2.37% 69.68% NA
Indica III  913 63.30% 2.20% 1.10% 33.41% NA
Indica Intermediate  786 55.00% 1.00% 2.16% 41.86% NA
Temperate Japonica  767 63.10% 1.00% 2.35% 33.51% NA
Tropical Japonica  504 42.90% 16.70% 0.20% 40.28% NA
Japonica Intermediate  241 55.60% 2.50% 0.83% 41.08% NA
VI/Aromatic  96 27.10% 0.00% 0.00% 72.92% NA
Intermediate  90 58.90% 3.30% 3.33% 34.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1128445952 C -> DEL LOC_Os11g47300.1 N frameshift_variant Average:44.137; most accessible tissue: Zhenshan97 flower, score: 87.906 N N N N
vg1128445952 C -> G LOC_Os11g47300.1 missense_variant ; p.Leu528Val; MODERATE nonsynonymous_codon ; L528V Average:44.137; most accessible tissue: Zhenshan97 flower, score: 87.906 unknown unknown TOLERATED 0.14

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1128445952 C G -0.03 -0.02 -0.01 -0.02 -0.02 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1128445952 NA 9.76E-07 mr1124 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128445952 4.05E-07 4.05E-07 mr1795 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251