Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1128445952:

Variant ID: vg1128445952 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 28445952
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCTAACTAATCTGCGTTGGATCAATTTTGCAGACAACCAACTCAGCAAACCAATACTGCCAGCTTCCCTCATGACGTTGGAGAATCTGCTGGGATTTGAT[C/G]
TCTCCAAGAATAGTATAGCTGGTCCAATCCCCAAAGAAATTAGTATGCTGACAAGACTTGTATGCTTGTTCCTCAGCGATAATAAACTCTCAGGTTCAAT

Reverse complement sequence

ATTGAACCTGAGAGTTTATTATCGCTGAGGAACAAGCATACAAGTCTTGTCAGCATACTAATTTCTTTGGGGATTGGACCAGCTATACTATTCTTGGAGA[G/C]
ATCAAATCCCAGCAGATTCTCCAACGTCATGAGGGAAGCTGGCAGTATTGGTTTGCTGAGTTGGTTGTCTGCAAAATTGATCCAACGCAGATTAGTTAGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.60%	2.80%	1.57%	39.06%	NA
All Indica	2759	57.20%	1.10%	1.78%	39.94%	NA
All Japonica	1512	55.20%	6.50%	1.39%	36.97%	NA
Aus	269	68.40%	0.00%	0.37%	31.23%	NA
Indica I	595	73.80%	0.20%	1.85%	24.20%	NA
Indica II	465	27.50%	0.40%	2.37%	69.68%	NA
Indica III	913	63.30%	2.20%	1.10%	33.41%	NA
Indica Intermediate	786	55.00%	1.00%	2.16%	41.86%	NA
Temperate Japonica	767	63.10%	1.00%	2.35%	33.51%	NA
Tropical Japonica	504	42.90%	16.70%	0.20%	40.28%	NA
Japonica Intermediate	241	55.60%	2.50%	0.83%	41.08%	NA
VI/Aromatic	96	27.10%	0.00%	0.00%	72.92%	NA
Intermediate	90	58.90%	3.30%	3.33%	34.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1128445952	C -> DEL	LOC_Os11g47300.1	N	frameshift_variant	Average:44.137; most accessible tissue: Zhenshan97 flower, score: 87.906	N	N	N	N
vg1128445952	C -> G	LOC_Os11g47300.1	missense_variant ; p.Leu528Val; MODERATE	nonsynonymous_codon ; L528V	Average:44.137; most accessible tissue: Zhenshan97 flower, score: 87.906	unknown	unknown	TOLERATED	0.14

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1128445952	C	G	-0.03	-0.02	-0.01	-0.02	-0.02	-0.04

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1128445952	NA	9.76E-07	mr1124	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128445952	4.05E-07	4.05E-07	mr1795	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251