\
| Variant ID: vg1128224267 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 28224267 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.63, C: 0.37, others allele: 0.00, population size: 54. )
TCACTGTCAAATTTACCTTATTCGCTCTAGTGCAGACGCCATGGATCGAACTGTAGAGCAGCTTGTCAACAAGTTAACTCAGGTGGTTTTACCAACCAAC[C/G]
CAAAGCAAGTGAATATTCCAGTGCTGTAACTGATCTCAATCAGACAGAACGGTTCATTTTTGCCATTCTAATTCCACCAGCGGATTGTGACGATATTTTG
CAAAATATCGTCACAATCCGCTGGTGGAATTAGAATGGCAAAAATGAACCGTTCTGTCTGATTGAGATCAGTTACAGCACTGGAATATTCACTTGCTTTG[G/C]
GTTGGTTGGTAAAACCACCTGAGTTAACTTGTTGACAAGCTGCTCTACAGTTCGATCCATGGCGTCTGCACTAGAGCGAATAAGGTAAATTTGACAGTGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 19.60% | 9.70% | 1.76% | 68.98% | NA |
| All Indica | 2759 | 26.30% | 9.70% | 1.92% | 62.09% | NA |
| All Japonica | 1512 | 8.20% | 10.80% | 0.60% | 80.42% | NA |
| Aus | 269 | 16.40% | 2.20% | 2.23% | 79.18% | NA |
| Indica I | 595 | 42.70% | 22.90% | 0.67% | 33.78% | NA |
| Indica II | 465 | 2.40% | 15.10% | 0.22% | 82.37% | NA |
| Indica III | 913 | 33.20% | 0.20% | 3.29% | 63.31% | NA |
| Indica Intermediate | 786 | 20.00% | 7.60% | 2.29% | 70.10% | NA |
| Temperate Japonica | 767 | 12.50% | 17.60% | 0.52% | 69.36% | NA |
| Tropical Japonica | 504 | 3.40% | 0.80% | 0.20% | 95.63% | NA |
| Japonica Intermediate | 241 | 4.60% | 10.00% | 1.66% | 83.82% | NA |
| VI/Aromatic | 96 | 15.60% | 3.10% | 13.54% | 67.71% | NA |
| Intermediate | 90 | 17.80% | 21.10% | 2.22% | 58.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1128224267 | C -> DEL | N | N | silent_mutation | Average:56.944; most accessible tissue: Callus, score: 83.014 | N | N | N | N |
| vg1128224267 | C -> G | LOC_Os11g46960.1 | upstream_gene_variant ; 67.0bp to feature; MODIFIER | silent_mutation | Average:56.944; most accessible tissue: Callus, score: 83.014 | N | N | N | N |
| vg1128224267 | C -> G | LOC_Os11g46970.1 | upstream_gene_variant ; 4646.0bp to feature; MODIFIER | silent_mutation | Average:56.944; most accessible tissue: Callus, score: 83.014 | N | N | N | N |
| vg1128224267 | C -> G | LOC_Os11g46950.1 | downstream_gene_variant ; 1003.0bp to feature; MODIFIER | silent_mutation | Average:56.944; most accessible tissue: Callus, score: 83.014 | N | N | N | N |
| vg1128224267 | C -> G | LOC_Os11g46950-LOC_Os11g46960 | intergenic_region ; MODIFIER | silent_mutation | Average:56.944; most accessible tissue: Callus, score: 83.014 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1128224267 | NA | 2.16E-06 | mr1295 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128224267 | 4.19E-07 | NA | mr1548 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128224267 | NA | 1.98E-06 | mr1644 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128224267 | 5.58E-06 | NA | mr1662 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128224267 | NA | 1.36E-06 | mr1662 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128224267 | NA | 1.36E-08 | mr1191_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128224267 | NA | 2.03E-06 | mr1662_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |