Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1127977155:

Variant ID: vg1127977155 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 27977155
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.84, A: 0.16, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:

TATGGACATGCAATTAATTGAATATATATATATATAGTACGGAGTAGATCTTAAAATATGTACTGCACACTACGACTCATCAGATTGCTCGAACTAGTTA[A/G]
TACTAATAGTACCATACATGTATGATGCATGTCACATGCAGCTGAGAGCCAGAGATCAGTACTTCTATATTTTTTTTCTTCTTCTTCTAGAATTCAATAT

Reverse complement sequence

ATATTGAATTCTAGAAGAAGAAGAAAAAAAATATAGAAGTACTGATCTCTGGCTCTCAGCTGCATGTGACATGCATCATACATGTATGGTACTATTAGTA[T/C]
TAACTAGTTCGAGCAATCTGATGAGTCGTAGTGTGCAGTACATATTTTAAGATCTACTCCGTACTATATATATATATATTCAATTAATTGCATGTCCATA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	35.50%	16.70%	0.74%	47.02%	NA
All Indica	2759	32.80%	18.10%	0.62%	48.53%	NA
All Japonica	1512	38.70%	13.40%	0.99%	46.89%	NA
Aus	269	49.80%	21.20%	0.37%	28.62%	NA
Indica I	595	16.30%	42.20%	0.67%	40.84%	NA
Indica II	465	15.30%	1.70%	0.86%	82.15%	NA
Indica III	913	54.80%	12.20%	0.33%	32.75%	NA
Indica Intermediate	786	30.00%	16.40%	0.76%	52.80%	NA
Temperate Japonica	767	28.00%	19.30%	0.78%	51.89%	NA
Tropical Japonica	504	53.80%	5.60%	1.39%	39.29%	NA
Japonica Intermediate	241	41.10%	11.20%	0.83%	46.89%	NA
VI/Aromatic	96	10.40%	24.00%	0.00%	65.62%	NA
Intermediate	90	50.00%	10.00%	2.22%	37.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1127977155	A -> DEL	N	N	silent_mutation	Average:29.342; most accessible tissue: Callus, score: 91.94	N	N	N	N
vg1127977155	A -> G	LOC_Os11g46190.1	upstream_gene_variant ; 2320.0bp to feature; MODIFIER	silent_mutation	Average:29.342; most accessible tissue: Callus, score: 91.94	N	N	N	N
vg1127977155	A -> G	LOC_Os11g46200.1	downstream_gene_variant ; 1213.0bp to feature; MODIFIER	silent_mutation	Average:29.342; most accessible tissue: Callus, score: 91.94	N	N	N	N
vg1127977155	A -> G	LOC_Os11g46190-LOC_Os11g46200	intergenic_region ; MODIFIER	silent_mutation	Average:29.342; most accessible tissue: Callus, score: 91.94	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1127977155	NA	3.57E-06	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127977155	NA	6.97E-08	mr1133	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127977155	NA	3.77E-06	mr1159	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127977155	NA	2.16E-06	mr1286	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127977155	2.92E-06	8.67E-09	mr1345	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127977155	NA	1.47E-06	mr1345	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127977155	NA	2.57E-07	mr1427	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127977155	NA	3.53E-06	mr1634	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127977155	NA	3.55E-07	mr1667	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127977155	NA	6.60E-06	mr1724	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127977155	NA	1.29E-07	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251