\
| Variant ID: vg1127977155 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 27977155 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.84, A: 0.16, others allele: 0.00, population size: 77. )
TATGGACATGCAATTAATTGAATATATATATATATAGTACGGAGTAGATCTTAAAATATGTACTGCACACTACGACTCATCAGATTGCTCGAACTAGTTA[A/G]
TACTAATAGTACCATACATGTATGATGCATGTCACATGCAGCTGAGAGCCAGAGATCAGTACTTCTATATTTTTTTTCTTCTTCTTCTAGAATTCAATAT
ATATTGAATTCTAGAAGAAGAAGAAAAAAAATATAGAAGTACTGATCTCTGGCTCTCAGCTGCATGTGACATGCATCATACATGTATGGTACTATTAGTA[T/C]
TAACTAGTTCGAGCAATCTGATGAGTCGTAGTGTGCAGTACATATTTTAAGATCTACTCCGTACTATATATATATATATTCAATTAATTGCATGTCCATA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.50% | 16.70% | 0.74% | 47.02% | NA |
| All Indica | 2759 | 32.80% | 18.10% | 0.62% | 48.53% | NA |
| All Japonica | 1512 | 38.70% | 13.40% | 0.99% | 46.89% | NA |
| Aus | 269 | 49.80% | 21.20% | 0.37% | 28.62% | NA |
| Indica I | 595 | 16.30% | 42.20% | 0.67% | 40.84% | NA |
| Indica II | 465 | 15.30% | 1.70% | 0.86% | 82.15% | NA |
| Indica III | 913 | 54.80% | 12.20% | 0.33% | 32.75% | NA |
| Indica Intermediate | 786 | 30.00% | 16.40% | 0.76% | 52.80% | NA |
| Temperate Japonica | 767 | 28.00% | 19.30% | 0.78% | 51.89% | NA |
| Tropical Japonica | 504 | 53.80% | 5.60% | 1.39% | 39.29% | NA |
| Japonica Intermediate | 241 | 41.10% | 11.20% | 0.83% | 46.89% | NA |
| VI/Aromatic | 96 | 10.40% | 24.00% | 0.00% | 65.62% | NA |
| Intermediate | 90 | 50.00% | 10.00% | 2.22% | 37.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1127977155 | A -> DEL | N | N | silent_mutation | Average:29.342; most accessible tissue: Callus, score: 91.94 | N | N | N | N |
| vg1127977155 | A -> G | LOC_Os11g46190.1 | upstream_gene_variant ; 2320.0bp to feature; MODIFIER | silent_mutation | Average:29.342; most accessible tissue: Callus, score: 91.94 | N | N | N | N |
| vg1127977155 | A -> G | LOC_Os11g46200.1 | downstream_gene_variant ; 1213.0bp to feature; MODIFIER | silent_mutation | Average:29.342; most accessible tissue: Callus, score: 91.94 | N | N | N | N |
| vg1127977155 | A -> G | LOC_Os11g46190-LOC_Os11g46200 | intergenic_region ; MODIFIER | silent_mutation | Average:29.342; most accessible tissue: Callus, score: 91.94 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1127977155 | NA | 3.57E-06 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127977155 | NA | 6.97E-08 | mr1133 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127977155 | NA | 3.77E-06 | mr1159 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127977155 | NA | 2.16E-06 | mr1286 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127977155 | 2.92E-06 | 8.67E-09 | mr1345 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127977155 | NA | 1.47E-06 | mr1345 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127977155 | NA | 2.57E-07 | mr1427 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127977155 | NA | 3.53E-06 | mr1634 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127977155 | NA | 3.55E-07 | mr1667 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127977155 | NA | 6.60E-06 | mr1724 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127977155 | NA | 1.29E-07 | mr1133_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |