\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127977155:

Variant ID: vg1127977155 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 27977155
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.84, A: 0.16, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:


TATGGACATGCAATTAATTGAATATATATATATATAGTACGGAGTAGATCTTAAAATATGTACTGCACACTACGACTCATCAGATTGCTCGAACTAGTTA[A/G]
TACTAATAGTACCATACATGTATGATGCATGTCACATGCAGCTGAGAGCCAGAGATCAGTACTTCTATATTTTTTTTCTTCTTCTTCTAGAATTCAATAT

Reverse complement sequence

ATATTGAATTCTAGAAGAAGAAGAAAAAAAATATAGAAGTACTGATCTCTGGCTCTCAGCTGCATGTGACATGCATCATACATGTATGGTACTATTAGTA[T/C]
TAACTAGTTCGAGCAATCTGATGAGTCGTAGTGTGCAGTACATATTTTAAGATCTACTCCGTACTATATATATATATATTCAATTAATTGCATGTCCATA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.50% 16.70% 0.74% 47.02% NA
All Indica  2759 32.80% 18.10% 0.62% 48.53% NA
All Japonica  1512 38.70% 13.40% 0.99% 46.89% NA
Aus  269 49.80% 21.20% 0.37% 28.62% NA
Indica I  595 16.30% 42.20% 0.67% 40.84% NA
Indica II  465 15.30% 1.70% 0.86% 82.15% NA
Indica III  913 54.80% 12.20% 0.33% 32.75% NA
Indica Intermediate  786 30.00% 16.40% 0.76% 52.80% NA
Temperate Japonica  767 28.00% 19.30% 0.78% 51.89% NA
Tropical Japonica  504 53.80% 5.60% 1.39% 39.29% NA
Japonica Intermediate  241 41.10% 11.20% 0.83% 46.89% NA
VI/Aromatic  96 10.40% 24.00% 0.00% 65.62% NA
Intermediate  90 50.00% 10.00% 2.22% 37.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1127977155 A -> DEL N N silent_mutation Average:29.342; most accessible tissue: Callus, score: 91.94 N N N N
vg1127977155 A -> G LOC_Os11g46190.1 upstream_gene_variant ; 2320.0bp to feature; MODIFIER silent_mutation Average:29.342; most accessible tissue: Callus, score: 91.94 N N N N
vg1127977155 A -> G LOC_Os11g46200.1 downstream_gene_variant ; 1213.0bp to feature; MODIFIER silent_mutation Average:29.342; most accessible tissue: Callus, score: 91.94 N N N N
vg1127977155 A -> G LOC_Os11g46190-LOC_Os11g46200 intergenic_region ; MODIFIER silent_mutation Average:29.342; most accessible tissue: Callus, score: 91.94 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1127977155 NA 3.57E-06 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127977155 NA 6.97E-08 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127977155 NA 3.77E-06 mr1159 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127977155 NA 2.16E-06 mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127977155 2.92E-06 8.67E-09 mr1345 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127977155 NA 1.47E-06 mr1345 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127977155 NA 2.57E-07 mr1427 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127977155 NA 3.53E-06 mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127977155 NA 3.55E-07 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127977155 NA 6.60E-06 mr1724 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127977155 NA 1.29E-07 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251