\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127845569:

Variant ID: vg1127845569 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 27845569
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, others allele: 0.00, population size: 45. )

Flanking Sequence (100 bp) in Reference Genome:


GTCAGGATTTGCCTCGGGCCCATTGCGATCGGACCATGGCCATTTTGTTTCATGATGGGCCAGGCAATGGTAACGACCCAATCTGAAAGGCTGGTCCAGT[G/C]
ATAATGGGCTATCTAATATACATCTAAAATAGTATTAATTTGAATTATTTTTTTTGAGAATAATTAAAAATCGGGCATTTTATTCATTAAGAACCAAGTT

Reverse complement sequence

AACTTGGTTCTTAATGAATAAAATGCCCGATTTTTAATTATTCTCAAAAAAAATAATTCAAATTAATACTATTTTAGATGTATATTAGATAGCCCATTAT[C/G]
ACTGGACCAGCCTTTCAGATTGGGTCGTTACCATTGCCTGGCCCATCATGAAACAAAATGGCCATGGTCCGATCGCAATGGGCCCGAGGCAAATCCTGAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.40% 38.20% 2.56% 14.83% NA
All Indica  2759 36.10% 35.40% 3.77% 24.72% NA
All Japonica  1512 58.50% 40.30% 0.66% 0.46% NA
Aus  269 53.90% 42.00% 1.49% 2.60% NA
Indica I  595 19.80% 56.00% 3.70% 20.50% NA
Indica II  465 21.10% 18.70% 6.88% 53.33% NA
Indica III  913 56.40% 31.90% 1.97% 9.75% NA
Indica Intermediate  786 33.70% 33.80% 4.07% 28.37% NA
Temperate Japonica  767 42.00% 57.10% 0.78% 0.13% NA
Tropical Japonica  504 82.50% 15.90% 0.60% 0.99% NA
Japonica Intermediate  241 61.00% 38.20% 0.41% 0.41% NA
VI/Aromatic  96 24.00% 74.00% 1.04% 1.04% NA
Intermediate  90 56.70% 36.70% 2.22% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1127845569 G -> DEL N N silent_mutation Average:72.965; most accessible tissue: Callus, score: 97.634 N N N N
vg1127845569 G -> C LOC_Os11g46000.3 3_prime_UTR_variant ; 758.0bp to feature; MODIFIER silent_mutation Average:72.965; most accessible tissue: Callus, score: 97.634 N N N N
vg1127845569 G -> C LOC_Os11g46000.1 downstream_gene_variant ; 187.0bp to feature; MODIFIER silent_mutation Average:72.965; most accessible tissue: Callus, score: 97.634 N N N N
vg1127845569 G -> C LOC_Os11g46010.1 downstream_gene_variant ; 4923.0bp to feature; MODIFIER silent_mutation Average:72.965; most accessible tissue: Callus, score: 97.634 N N N N
vg1127845569 G -> C LOC_Os11g46000.2 downstream_gene_variant ; 1681.0bp to feature; MODIFIER silent_mutation Average:72.965; most accessible tissue: Callus, score: 97.634 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1127845569 G C 0.06 0.08 0.05 0.06 0.05 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1127845569 1.56E-06 NA mr1108 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127845569 NA 1.56E-06 mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127845569 4.70E-06 4.70E-06 mr1232 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127845569 NA 5.31E-06 mr1279 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127845569 NA 3.87E-07 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127845569 NA 1.24E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127845569 NA 5.18E-06 mr1427 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127845569 NA 4.35E-08 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127845569 NA 6.68E-06 mr1474 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127845569 NA 6.68E-06 mr1475 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127845569 9.39E-07 9.37E-07 mr1562 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127845569 NA 9.91E-06 mr1606 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127845569 3.96E-06 1.83E-06 mr1724 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127845569 NA 4.52E-06 mr1446_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251