\
| Variant ID: vg1127797000 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 27797000 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 263. )
CCTGCGACGCCTGTGCTTTGTCATGAAAATTATGACTTCAGCTCTAACAACAATTGAACAAGGGGCTCTATCGAACCTCGTCTCGCTTCAGCTGCTCTGT[C/G]
AAGGTCTAGTTGGTCTTTCCGGCATTGAGATCAGACACCTGAAACATCTTAAGGAAATCACCATCGACTCTGCAGTGACTGTACAAACAAGACAAGATTG
CAATCTTGTCTTGTTTGTACAGTCACTGCAGAGTCGATGGTGATTTCCTTAAGATGTTTCAGGTGTCTGATCTCAATGCCGGAAAGACCAACTAGACCTT[G/C]
ACAGAGCAGCTGAAGCGAGACGAGGTTCGATAGAGCCCCTTGTTCAATTGTTGTTAGAGCTGAAGTCATAATTTTCATGACAAAGCACAGGCGTCGCAGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.00% | 0.30% | 0.19% | 3.51% | NA |
| All Indica | 2759 | 93.40% | 0.50% | 0.33% | 5.76% | NA |
| All Japonica | 1512 | 99.70% | 0.10% | 0.00% | 0.20% | NA |
| Aus | 269 | 98.90% | 0.40% | 0.00% | 0.74% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 80.60% | 1.90% | 0.86% | 16.56% | NA |
| Indica III | 913 | 98.20% | 0.00% | 0.00% | 1.75% | NA |
| Indica Intermediate | 786 | 90.30% | 0.60% | 0.64% | 8.40% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.20% | 0.00% | 0.60% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 0.00% | 0.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1127797000 | C -> DEL | LOC_Os11g45930.1 | N | frameshift_variant | Average:70.409; most accessible tissue: Zhenshan97 flower, score: 86.268 | N | N | N | N |
| vg1127797000 | C -> G | LOC_Os11g45930.1 | missense_variant ; p.Gln973Glu; MODERATE | nonsynonymous_codon ; Q973E | Average:70.409; most accessible tissue: Zhenshan97 flower, score: 86.268 | benign |
0.998 |
TOLERATED | 0.36 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1127797000 | 2.09E-08 | 3.02E-09 | mr1238 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127797000 | NA | 5.38E-06 | mr1309 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127797000 | NA | 1.38E-06 | mr1841 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127797000 | 7.87E-11 | 4.64E-11 | mr1238_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127797000 | 4.92E-12 | 1.95E-12 | mr1484_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127797000 | 1.62E-11 | 4.35E-11 | mr1841_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127797000 | 1.42E-07 | 3.33E-08 | mr1900_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127797000 | 1.44E-09 | 1.44E-09 | mr1945_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |