Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1127762582:

Variant ID: vg1127762582 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 27762582
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.86, A: 0.12, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:

AGCAAAGGATAGGGCTTTGCAACCTTTCGAACGAGAAATCCCACTCAATAAAATATTGCGAGCTTTGCAATTGTTGTTAAATTCAGTTTTCAAAGCCACA[A/G]
TATCAATTTGTTCAGGAATCACATAAGGCTGAGCAACCTTTTGCCAAACATCATAATCTTCAGCCATAATGTAAGATTGCATCTTGTCACACCAATAAGA

Reverse complement sequence

TCTTATTGGTGTGACAAGATGCAATCTTACATTATGGCTGAAGATTATGATGTTTGGCAAAAGGTTGCTCAGCCTTATGTGATTCCTGAACAAATTGATA[T/C]
TGTGGCTTTGAAAACTGAATTTAACAACAATTGCAAAGCTCGCAATATTTTATTGAGTGGGATTTCTCGTTCGAAAGGTTGCAAAGCCCTATCCTTTGCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	37.10%	26.50%	0.42%	35.91%	NA
All Indica	2759	26.00%	32.90%	0.43%	40.63%	NA
All Japonica	1512	61.40%	17.30%	0.33%	21.03%	NA
Aus	269	18.20%	14.10%	0.37%	67.29%	NA
Indica I	595	24.40%	19.50%	0.67%	55.46%	NA
Indica II	465	26.50%	11.40%	0.22%	61.94%	NA
Indica III	913	29.10%	53.60%	0.11%	17.20%	NA
Indica Intermediate	786	23.30%	31.90%	0.76%	44.02%	NA
Temperate Japonica	767	62.70%	20.30%	0.26%	16.69%	NA
Tropical Japonica	504	52.20%	17.70%	0.20%	29.96%	NA
Japonica Intermediate	241	76.30%	6.60%	0.83%	16.18%	NA
VI/Aromatic	96	29.20%	10.40%	2.08%	58.33%	NA
Intermediate	90	36.70%	40.00%	0.00%	23.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1127762582	A -> DEL	N	N	silent_mutation	Average:28.958; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg1127762582	A -> G	LOC_Os11g45890.1	upstream_gene_variant ; 935.0bp to feature; MODIFIER	silent_mutation	Average:28.958; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg1127762582	A -> G	LOC_Os11g45899.1	upstream_gene_variant ; 2349.0bp to feature; MODIFIER	silent_mutation	Average:28.958; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg1127762582	A -> G	LOC_Os11g45890-LOC_Os11g45899	intergenic_region ; MODIFIER	silent_mutation	Average:28.958; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1127762582	9.08E-06	9.08E-06	mr1041	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127762582	NA	3.03E-06	mr1044	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127762582	2.23E-09	NA	mr1133	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127762582	2.29E-06	2.75E-11	mr1133	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127762582	NA	4.58E-07	mr1667	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127762582	3.53E-07	NA	mr1133_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127762582	1.11E-06	1.40E-11	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127762582	NA	4.79E-08	mr1667_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251