\
| Variant ID: vg1127762582 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 27762582 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.86, A: 0.12, others allele: 0.00, population size: 80. )
AGCAAAGGATAGGGCTTTGCAACCTTTCGAACGAGAAATCCCACTCAATAAAATATTGCGAGCTTTGCAATTGTTGTTAAATTCAGTTTTCAAAGCCACA[A/G]
TATCAATTTGTTCAGGAATCACATAAGGCTGAGCAACCTTTTGCCAAACATCATAATCTTCAGCCATAATGTAAGATTGCATCTTGTCACACCAATAAGA
TCTTATTGGTGTGACAAGATGCAATCTTACATTATGGCTGAAGATTATGATGTTTGGCAAAAGGTTGCTCAGCCTTATGTGATTCCTGAACAAATTGATA[T/C]
TGTGGCTTTGAAAACTGAATTTAACAACAATTGCAAAGCTCGCAATATTTTATTGAGTGGGATTTCTCGTTCGAAAGGTTGCAAAGCCCTATCCTTTGCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 37.10% | 26.50% | 0.42% | 35.91% | NA |
| All Indica | 2759 | 26.00% | 32.90% | 0.43% | 40.63% | NA |
| All Japonica | 1512 | 61.40% | 17.30% | 0.33% | 21.03% | NA |
| Aus | 269 | 18.20% | 14.10% | 0.37% | 67.29% | NA |
| Indica I | 595 | 24.40% | 19.50% | 0.67% | 55.46% | NA |
| Indica II | 465 | 26.50% | 11.40% | 0.22% | 61.94% | NA |
| Indica III | 913 | 29.10% | 53.60% | 0.11% | 17.20% | NA |
| Indica Intermediate | 786 | 23.30% | 31.90% | 0.76% | 44.02% | NA |
| Temperate Japonica | 767 | 62.70% | 20.30% | 0.26% | 16.69% | NA |
| Tropical Japonica | 504 | 52.20% | 17.70% | 0.20% | 29.96% | NA |
| Japonica Intermediate | 241 | 76.30% | 6.60% | 0.83% | 16.18% | NA |
| VI/Aromatic | 96 | 29.20% | 10.40% | 2.08% | 58.33% | NA |
| Intermediate | 90 | 36.70% | 40.00% | 0.00% | 23.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1127762582 | A -> DEL | N | N | silent_mutation | Average:28.958; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| vg1127762582 | A -> G | LOC_Os11g45890.1 | upstream_gene_variant ; 935.0bp to feature; MODIFIER | silent_mutation | Average:28.958; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| vg1127762582 | A -> G | LOC_Os11g45899.1 | upstream_gene_variant ; 2349.0bp to feature; MODIFIER | silent_mutation | Average:28.958; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| vg1127762582 | A -> G | LOC_Os11g45890-LOC_Os11g45899 | intergenic_region ; MODIFIER | silent_mutation | Average:28.958; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1127762582 | 9.08E-06 | 9.08E-06 | mr1041 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127762582 | NA | 3.03E-06 | mr1044 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127762582 | 2.23E-09 | NA | mr1133 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127762582 | 2.29E-06 | 2.75E-11 | mr1133 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127762582 | NA | 4.58E-07 | mr1667 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127762582 | 3.53E-07 | NA | mr1133_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127762582 | 1.11E-06 | 1.40E-11 | mr1133_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127762582 | NA | 4.79E-08 | mr1667_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |