\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127762582:

Variant ID: vg1127762582 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 27762582
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.86, A: 0.12, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


AGCAAAGGATAGGGCTTTGCAACCTTTCGAACGAGAAATCCCACTCAATAAAATATTGCGAGCTTTGCAATTGTTGTTAAATTCAGTTTTCAAAGCCACA[A/G]
TATCAATTTGTTCAGGAATCACATAAGGCTGAGCAACCTTTTGCCAAACATCATAATCTTCAGCCATAATGTAAGATTGCATCTTGTCACACCAATAAGA

Reverse complement sequence

TCTTATTGGTGTGACAAGATGCAATCTTACATTATGGCTGAAGATTATGATGTTTGGCAAAAGGTTGCTCAGCCTTATGTGATTCCTGAACAAATTGATA[T/C]
TGTGGCTTTGAAAACTGAATTTAACAACAATTGCAAAGCTCGCAATATTTTATTGAGTGGGATTTCTCGTTCGAAAGGTTGCAAAGCCCTATCCTTTGCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.10% 26.50% 0.42% 35.91% NA
All Indica  2759 26.00% 32.90% 0.43% 40.63% NA
All Japonica  1512 61.40% 17.30% 0.33% 21.03% NA
Aus  269 18.20% 14.10% 0.37% 67.29% NA
Indica I  595 24.40% 19.50% 0.67% 55.46% NA
Indica II  465 26.50% 11.40% 0.22% 61.94% NA
Indica III  913 29.10% 53.60% 0.11% 17.20% NA
Indica Intermediate  786 23.30% 31.90% 0.76% 44.02% NA
Temperate Japonica  767 62.70% 20.30% 0.26% 16.69% NA
Tropical Japonica  504 52.20% 17.70% 0.20% 29.96% NA
Japonica Intermediate  241 76.30% 6.60% 0.83% 16.18% NA
VI/Aromatic  96 29.20% 10.40% 2.08% 58.33% NA
Intermediate  90 36.70% 40.00% 0.00% 23.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1127762582 A -> DEL N N silent_mutation Average:28.958; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg1127762582 A -> G LOC_Os11g45890.1 upstream_gene_variant ; 935.0bp to feature; MODIFIER silent_mutation Average:28.958; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg1127762582 A -> G LOC_Os11g45899.1 upstream_gene_variant ; 2349.0bp to feature; MODIFIER silent_mutation Average:28.958; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg1127762582 A -> G LOC_Os11g45890-LOC_Os11g45899 intergenic_region ; MODIFIER silent_mutation Average:28.958; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1127762582 9.08E-06 9.08E-06 mr1041 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127762582 NA 3.03E-06 mr1044 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127762582 2.23E-09 NA mr1133 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127762582 2.29E-06 2.75E-11 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127762582 NA 4.58E-07 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127762582 3.53E-07 NA mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127762582 1.11E-06 1.40E-11 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127762582 NA 4.79E-08 mr1667_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251