Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1127578048:

Variant ID: vg1127578048 (JBrowse)	Variation Type: INDEL
Chromosome: chr11	Position: 27578048
Reference Allele: G	Alternative Allele: A,GAAATTAAAAATTA
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.81, G: 0.18, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:

TATATGCGTACTTCCTAGTTAAATGAATGAGCAGTGTCCTGCTTAATGTCTAAAGTCTAAACTCGAATACATGGTGCCACACGGCCGAAAGTGATCCCAC[G/A,GAAATTAAAAATTA]
ACCTACTCTTCATCGTTTTCTAAAAAATGATTCAATATTTCAAACTGATCCTCAAAAGACAAATGAAAGTATGATAAATTGGTCTTATAAAACACGTTAA

Reverse complement sequence

TTAACGTGTTTTATAAGACCAATTTATCATACTTTCATTTGTCTTTTGAGGATCAGTTTGAAATATTGAATCATTTTTTAGAAAACGATGAAGAGTAGGT[C/T,TAATTTTTAATTTC]
GTGGGATCACTTTCGGCCGTGTGGCACCATGTATTCGAGTTTAGACTTTAGACATTAAGCAGGACACTGCTCATTCATTTAACTAGGAAGTACGCATATA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.70%	46.00%	0.55%	0.00%	GAAATTAAAAATTA: 1.69%
All Indica	2759	41.10%	55.70%	0.43%	0.00%	GAAATTAAAAATTA: 2.72%
All Japonica	1512	74.40%	25.00%	0.26%	0.00%	GAAATTAAAAATTA: 0.33%
Aus	269	41.30%	55.80%	2.97%	0.00%	NA
Indica I	595	17.80%	81.80%	0.17%	0.00%	GAAATTAAAAATTA: 0.17%
Indica II	465	16.10%	82.40%	0.65%	0.00%	GAAATTAAAAATTA: 0.86%
Indica III	913	70.10%	25.70%	0.11%	0.00%	GAAATTAAAAATTA: 4.05%
Indica Intermediate	786	39.80%	55.10%	0.89%	0.00%	GAAATTAAAAATTA: 4.20%
Temperate Japonica	767	79.50%	19.40%	0.39%	0.00%	GAAATTAAAAATTA: 0.65%
Tropical Japonica	504	70.80%	29.20%	0.00%	0.00%	NA
Japonica Intermediate	241	65.60%	34.00%	0.41%	0.00%	NA
VI/Aromatic	96	28.10%	71.90%	0.00%	0.00%	NA
Intermediate	90	53.30%	44.40%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1127578048	G -> A	LOC_Os11g45540.1	upstream_gene_variant ; 3935.0bp to feature; MODIFIER	silent_mutation	Average:51.716; most accessible tissue: Callus, score: 94.191	N	N	N	N
vg1127578048	G -> A	LOC_Os11g45550.1	upstream_gene_variant ; 2020.0bp to feature; MODIFIER	silent_mutation	Average:51.716; most accessible tissue: Callus, score: 94.191	N	N	N	N
vg1127578048	G -> A	LOC_Os11g45570.1	downstream_gene_variant ; 4170.0bp to feature; MODIFIER	silent_mutation	Average:51.716; most accessible tissue: Callus, score: 94.191	N	N	N	N
vg1127578048	G -> A	LOC_Os11g45560.1	intron_variant ; MODIFIER	silent_mutation	Average:51.716; most accessible tissue: Callus, score: 94.191	N	N	N	N
vg1127578048	G -> GAAATTAAAAATTA	LOC_Os11g45540.1	upstream_gene_variant ; 3936.0bp to feature; MODIFIER	silent_mutation	Average:51.716; most accessible tissue: Callus, score: 94.191	N	N	N	N
vg1127578048	G -> GAAATTAAAAATTA	LOC_Os11g45550.1	upstream_gene_variant ; 2021.0bp to feature; MODIFIER	silent_mutation	Average:51.716; most accessible tissue: Callus, score: 94.191	N	N	N	N
vg1127578048	G -> GAAATTAAAAATTA	LOC_Os11g45570.1	downstream_gene_variant ; 4169.0bp to feature; MODIFIER	silent_mutation	Average:51.716; most accessible tissue: Callus, score: 94.191	N	N	N	N
vg1127578048	G -> GAAATTAAAAATTA	LOC_Os11g45560.1	intron_variant ; MODIFIER	silent_mutation	Average:51.716; most accessible tissue: Callus, score: 94.191	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1127578048	NA	1.73E-06	mr1063	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127578048	NA	2.76E-11	mr1133	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127578048	8.99E-06	NA	mr1667	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127578048	NA	1.33E-06	mr1667	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127578048	5.08E-07	NA	mr1133_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127578048	NA	1.73E-11	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127578048	2.68E-06	2.68E-06	mr1172_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127578048	1.84E-06	1.84E-06	mr1399_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127578048	2.54E-06	NA	mr1667_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127578048	NA	2.73E-06	mr1667_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127578048	NA	7.18E-06	mr1908_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127578048	NA	3.67E-06	mr1996_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251