\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127578048:

Variant ID: vg1127578048 (JBrowse)Variation Type: INDEL
Chromosome: chr11Position: 27578048
Reference Allele: GAlternative Allele: A,GAAATTAAAAATTA
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.81, G: 0.18, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


TATATGCGTACTTCCTAGTTAAATGAATGAGCAGTGTCCTGCTTAATGTCTAAAGTCTAAACTCGAATACATGGTGCCACACGGCCGAAAGTGATCCCAC[G/A,GAAATTAAAAATTA]
ACCTACTCTTCATCGTTTTCTAAAAAATGATTCAATATTTCAAACTGATCCTCAAAAGACAAATGAAAGTATGATAAATTGGTCTTATAAAACACGTTAA

Reverse complement sequence

TTAACGTGTTTTATAAGACCAATTTATCATACTTTCATTTGTCTTTTGAGGATCAGTTTGAAATATTGAATCATTTTTTAGAAAACGATGAAGAGTAGGT[C/T,TAATTTTTAATTTC]
GTGGGATCACTTTCGGCCGTGTGGCACCATGTATTCGAGTTTAGACTTTAGACATTAAGCAGGACACTGCTCATTCATTTAACTAGGAAGTACGCATATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.70% 46.00% 0.55% 0.00% GAAATTAAAAATTA: 1.69%
All Indica  2759 41.10% 55.70% 0.43% 0.00% GAAATTAAAAATTA: 2.72%
All Japonica  1512 74.40% 25.00% 0.26% 0.00% GAAATTAAAAATTA: 0.33%
Aus  269 41.30% 55.80% 2.97% 0.00% NA
Indica I  595 17.80% 81.80% 0.17% 0.00% GAAATTAAAAATTA: 0.17%
Indica II  465 16.10% 82.40% 0.65% 0.00% GAAATTAAAAATTA: 0.86%
Indica III  913 70.10% 25.70% 0.11% 0.00% GAAATTAAAAATTA: 4.05%
Indica Intermediate  786 39.80% 55.10% 0.89% 0.00% GAAATTAAAAATTA: 4.20%
Temperate Japonica  767 79.50% 19.40% 0.39% 0.00% GAAATTAAAAATTA: 0.65%
Tropical Japonica  504 70.80% 29.20% 0.00% 0.00% NA
Japonica Intermediate  241 65.60% 34.00% 0.41% 0.00% NA
VI/Aromatic  96 28.10% 71.90% 0.00% 0.00% NA
Intermediate  90 53.30% 44.40% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1127578048 G -> A LOC_Os11g45540.1 upstream_gene_variant ; 3935.0bp to feature; MODIFIER silent_mutation Average:51.716; most accessible tissue: Callus, score: 94.191 N N N N
vg1127578048 G -> A LOC_Os11g45550.1 upstream_gene_variant ; 2020.0bp to feature; MODIFIER silent_mutation Average:51.716; most accessible tissue: Callus, score: 94.191 N N N N
vg1127578048 G -> A LOC_Os11g45570.1 downstream_gene_variant ; 4170.0bp to feature; MODIFIER silent_mutation Average:51.716; most accessible tissue: Callus, score: 94.191 N N N N
vg1127578048 G -> A LOC_Os11g45560.1 intron_variant ; MODIFIER silent_mutation Average:51.716; most accessible tissue: Callus, score: 94.191 N N N N
vg1127578048 G -> GAAATTAAAAATTA LOC_Os11g45540.1 upstream_gene_variant ; 3936.0bp to feature; MODIFIER silent_mutation Average:51.716; most accessible tissue: Callus, score: 94.191 N N N N
vg1127578048 G -> GAAATTAAAAATTA LOC_Os11g45550.1 upstream_gene_variant ; 2021.0bp to feature; MODIFIER silent_mutation Average:51.716; most accessible tissue: Callus, score: 94.191 N N N N
vg1127578048 G -> GAAATTAAAAATTA LOC_Os11g45570.1 downstream_gene_variant ; 4169.0bp to feature; MODIFIER silent_mutation Average:51.716; most accessible tissue: Callus, score: 94.191 N N N N
vg1127578048 G -> GAAATTAAAAATTA LOC_Os11g45560.1 intron_variant ; MODIFIER silent_mutation Average:51.716; most accessible tissue: Callus, score: 94.191 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1127578048 NA 1.73E-06 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127578048 NA 2.76E-11 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127578048 8.99E-06 NA mr1667 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127578048 NA 1.33E-06 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127578048 5.08E-07 NA mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127578048 NA 1.73E-11 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127578048 2.68E-06 2.68E-06 mr1172_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127578048 1.84E-06 1.84E-06 mr1399_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127578048 2.54E-06 NA mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127578048 NA 2.73E-06 mr1667_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127578048 NA 7.18E-06 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127578048 NA 3.67E-06 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251