\
| Variant ID: vg1127578048 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr11 | Position: 27578048 |
| Reference Allele: G | Alternative Allele: A,GAAATTAAAAATTA |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.81, G: 0.18, others allele: 0.00, population size: 80. )
TATATGCGTACTTCCTAGTTAAATGAATGAGCAGTGTCCTGCTTAATGTCTAAAGTCTAAACTCGAATACATGGTGCCACACGGCCGAAAGTGATCCCAC[G/A,GAAATTAAAAATTA]
ACCTACTCTTCATCGTTTTCTAAAAAATGATTCAATATTTCAAACTGATCCTCAAAAGACAAATGAAAGTATGATAAATTGGTCTTATAAAACACGTTAA
TTAACGTGTTTTATAAGACCAATTTATCATACTTTCATTTGTCTTTTGAGGATCAGTTTGAAATATTGAATCATTTTTTAGAAAACGATGAAGAGTAGGT[C/T,TAATTTTTAATTTC]
GTGGGATCACTTTCGGCCGTGTGGCACCATGTATTCGAGTTTAGACTTTAGACATTAAGCAGGACACTGCTCATTCATTTAACTAGGAAGTACGCATATA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.70% | 46.00% | 0.55% | 0.00% | GAAATTAAAAATTA: 1.69% |
| All Indica | 2759 | 41.10% | 55.70% | 0.43% | 0.00% | GAAATTAAAAATTA: 2.72% |
| All Japonica | 1512 | 74.40% | 25.00% | 0.26% | 0.00% | GAAATTAAAAATTA: 0.33% |
| Aus | 269 | 41.30% | 55.80% | 2.97% | 0.00% | NA |
| Indica I | 595 | 17.80% | 81.80% | 0.17% | 0.00% | GAAATTAAAAATTA: 0.17% |
| Indica II | 465 | 16.10% | 82.40% | 0.65% | 0.00% | GAAATTAAAAATTA: 0.86% |
| Indica III | 913 | 70.10% | 25.70% | 0.11% | 0.00% | GAAATTAAAAATTA: 4.05% |
| Indica Intermediate | 786 | 39.80% | 55.10% | 0.89% | 0.00% | GAAATTAAAAATTA: 4.20% |
| Temperate Japonica | 767 | 79.50% | 19.40% | 0.39% | 0.00% | GAAATTAAAAATTA: 0.65% |
| Tropical Japonica | 504 | 70.80% | 29.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 65.60% | 34.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 28.10% | 71.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 53.30% | 44.40% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1127578048 | G -> A | LOC_Os11g45540.1 | upstream_gene_variant ; 3935.0bp to feature; MODIFIER | silent_mutation | Average:51.716; most accessible tissue: Callus, score: 94.191 | N | N | N | N |
| vg1127578048 | G -> A | LOC_Os11g45550.1 | upstream_gene_variant ; 2020.0bp to feature; MODIFIER | silent_mutation | Average:51.716; most accessible tissue: Callus, score: 94.191 | N | N | N | N |
| vg1127578048 | G -> A | LOC_Os11g45570.1 | downstream_gene_variant ; 4170.0bp to feature; MODIFIER | silent_mutation | Average:51.716; most accessible tissue: Callus, score: 94.191 | N | N | N | N |
| vg1127578048 | G -> A | LOC_Os11g45560.1 | intron_variant ; MODIFIER | silent_mutation | Average:51.716; most accessible tissue: Callus, score: 94.191 | N | N | N | N |
| vg1127578048 | G -> GAAATTAAAAATTA | LOC_Os11g45540.1 | upstream_gene_variant ; 3936.0bp to feature; MODIFIER | silent_mutation | Average:51.716; most accessible tissue: Callus, score: 94.191 | N | N | N | N |
| vg1127578048 | G -> GAAATTAAAAATTA | LOC_Os11g45550.1 | upstream_gene_variant ; 2021.0bp to feature; MODIFIER | silent_mutation | Average:51.716; most accessible tissue: Callus, score: 94.191 | N | N | N | N |
| vg1127578048 | G -> GAAATTAAAAATTA | LOC_Os11g45570.1 | downstream_gene_variant ; 4169.0bp to feature; MODIFIER | silent_mutation | Average:51.716; most accessible tissue: Callus, score: 94.191 | N | N | N | N |
| vg1127578048 | G -> GAAATTAAAAATTA | LOC_Os11g45560.1 | intron_variant ; MODIFIER | silent_mutation | Average:51.716; most accessible tissue: Callus, score: 94.191 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1127578048 | NA | 1.73E-06 | mr1063 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127578048 | NA | 2.76E-11 | mr1133 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127578048 | 8.99E-06 | NA | mr1667 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127578048 | NA | 1.33E-06 | mr1667 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127578048 | 5.08E-07 | NA | mr1133_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127578048 | NA | 1.73E-11 | mr1133_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127578048 | 2.68E-06 | 2.68E-06 | mr1172_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127578048 | 1.84E-06 | 1.84E-06 | mr1399_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127578048 | 2.54E-06 | NA | mr1667_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127578048 | NA | 2.73E-06 | mr1667_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127578048 | NA | 7.18E-06 | mr1908_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127578048 | NA | 3.67E-06 | mr1996_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |