Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127573468:

Variant ID: vg1127573468 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 27573468
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

GCGAAGTTGGCCGTCGCCAGATCGCTGAAATTCTGAAGACAGTTGTAGCAGATATCTTCAACCAAATCTGGAGCACACTGTGCCAAGCAGAAGAGCCTCC[T/G]
TGGAAGGGTAACGGTGTTGCTTGCATCGGCATCATCCATGTCCACGCGGATTGCAGCGTAGTGCTTCGTCGTGGAGAGAGCTTGTGCTACTATGTAATTC

Reverse complement sequence

GAATTACATAGTAGCACAAGCTCTCTCCACGACGAAGCACTACGCTGCAATCCGCGTGGACATGGATGATGCCGATGCAAGCAACACCGTTACCCTTCCA[A/C]
GGAGGCTCTTCTGCTTGGCACAGTGTGCTCCAGATTTGGTTGAAGATATCTGCTACAACTGTCTTCAGAATTTCAGCGATCTGGCGACGGCCAACTTCGC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.20%	45.20%	2.03%	1.54%	NA
All Indica	2759	47.10%	49.40%	2.46%	1.09%	NA
All Japonica	1512	63.30%	35.90%	0.60%	0.20%	NA
Aus	269	16.70%	62.50%	5.95%	14.87%	NA
Indica I	595	68.10%	24.50%	5.88%	1.51%	NA
Indica II	465	83.40%	15.90%	0.43%	0.22%	NA
Indica III	913	14.60%	83.70%	0.44%	1.31%	NA
Indica Intermediate	786	47.50%	48.10%	3.44%	1.02%	NA
Temperate Japonica	767	78.50%	20.70%	0.65%	0.13%	NA
Tropical Japonica	504	38.10%	60.90%	0.60%	0.40%	NA
Japonica Intermediate	241	67.60%	32.00%	0.41%	0.00%	NA
VI/Aromatic	96	65.60%	33.30%	1.04%	0.00%	NA
Intermediate	90	64.40%	33.30%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1127573468	T -> DEL	LOC_Os11g45540.1	N	frameshift_variant	Average:71.763; most accessible tissue: Minghui63 flag leaf, score: 84.608	N	N	N	N
vg1127573468	T -> G	LOC_Os11g45540.1	synonymous_variant ; p.Arg216Arg; LOW	synonymous_codon	Average:71.763; most accessible tissue: Minghui63 flag leaf, score: 84.608	N	N	N	N
vg1127573468	T -> G	LOC_Os11g45540.1	synonymous_variant ; p.Arg216Arg; LOW	nonsynonymous_codon ; R216Q	Average:71.763; most accessible tissue: Minghui63 flag leaf, score: 84.608	benign	1.092	TOLERATED	0.54

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1127573468	NA	1.76E-08	mr1063	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127573468	NA	3.80E-06	mr1125	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127573468	1.03E-06	NA	mr1133	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127573468	1.00E-06	2.90E-16	mr1133	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127573468	1.05E-06	NA	mr1540	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127573468	3.95E-06	NA	mr1667	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127573468	7.76E-06	1.30E-09	mr1667	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127573468	NA	1.36E-08	mr1063_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127573468	NA	2.95E-11	mr1065_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127573468	NA	8.27E-07	mr1096_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127573468	NA	5.91E-08	mr1125_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127573468	1.92E-07	NA	mr1133_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127573468	1.24E-07	1.44E-16	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127573468	NA	1.57E-06	mr1144_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127573468	NA	4.66E-06	mr1540_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127573468	NA	6.49E-10	mr1667_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251