\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127573468:

Variant ID: vg1127573468 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 27573468
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


GCGAAGTTGGCCGTCGCCAGATCGCTGAAATTCTGAAGACAGTTGTAGCAGATATCTTCAACCAAATCTGGAGCACACTGTGCCAAGCAGAAGAGCCTCC[T/G]
TGGAAGGGTAACGGTGTTGCTTGCATCGGCATCATCCATGTCCACGCGGATTGCAGCGTAGTGCTTCGTCGTGGAGAGAGCTTGTGCTACTATGTAATTC

Reverse complement sequence

GAATTACATAGTAGCACAAGCTCTCTCCACGACGAAGCACTACGCTGCAATCCGCGTGGACATGGATGATGCCGATGCAAGCAACACCGTTACCCTTCCA[A/C]
GGAGGCTCTTCTGCTTGGCACAGTGTGCTCCAGATTTGGTTGAAGATATCTGCTACAACTGTCTTCAGAATTTCAGCGATCTGGCGACGGCCAACTTCGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.20% 45.20% 2.03% 1.54% NA
All Indica  2759 47.10% 49.40% 2.46% 1.09% NA
All Japonica  1512 63.30% 35.90% 0.60% 0.20% NA
Aus  269 16.70% 62.50% 5.95% 14.87% NA
Indica I  595 68.10% 24.50% 5.88% 1.51% NA
Indica II  465 83.40% 15.90% 0.43% 0.22% NA
Indica III  913 14.60% 83.70% 0.44% 1.31% NA
Indica Intermediate  786 47.50% 48.10% 3.44% 1.02% NA
Temperate Japonica  767 78.50% 20.70% 0.65% 0.13% NA
Tropical Japonica  504 38.10% 60.90% 0.60% 0.40% NA
Japonica Intermediate  241 67.60% 32.00% 0.41% 0.00% NA
VI/Aromatic  96 65.60% 33.30% 1.04% 0.00% NA
Intermediate  90 64.40% 33.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1127573468 T -> DEL LOC_Os11g45540.1 N frameshift_variant Average:71.763; most accessible tissue: Minghui63 flag leaf, score: 84.608 N N N N
vg1127573468 T -> G LOC_Os11g45540.1 synonymous_variant ; p.Arg216Arg; LOW synonymous_codon Average:71.763; most accessible tissue: Minghui63 flag leaf, score: 84.608 N N N N
vg1127573468 T -> G LOC_Os11g45540.1 synonymous_variant ; p.Arg216Arg; LOW nonsynonymous_codon ; R216Q Average:71.763; most accessible tissue: Minghui63 flag leaf, score: 84.608 benign 1.092 TOLERATED 0.54

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1127573468 NA 1.76E-08 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127573468 NA 3.80E-06 mr1125 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127573468 1.03E-06 NA mr1133 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127573468 1.00E-06 2.90E-16 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127573468 1.05E-06 NA mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127573468 3.95E-06 NA mr1667 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127573468 7.76E-06 1.30E-09 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127573468 NA 1.36E-08 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127573468 NA 2.95E-11 mr1065_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127573468 NA 8.27E-07 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127573468 NA 5.91E-08 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127573468 1.92E-07 NA mr1133_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127573468 1.24E-07 1.44E-16 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127573468 NA 1.57E-06 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127573468 NA 4.66E-06 mr1540_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127573468 NA 6.49E-10 mr1667_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251