Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127411416:

Variant ID: vg1127411416 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 27411416
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.72, C: 0.28, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:

TAAAGTTTCAATTTTTTTTTTTGGGGGGGGGGGGGTGATTGTTGTAGCAAAGCCCTAGATTTGTGAGATTTTTAGGGGTTTTATGCCACGAATTTGTAGA[T/C]
CTGATCATTACCCAGAACCACGAAGCCCTAGATTTGTGTGTATTGAATGGTCTTTACTTATAAACTTGCAGATCTGGACATGAACAGGAATAATGAATTT

Reverse complement sequence

AAATTCATTATTCCTGTTCATGTCCAGATCTGCAAGTTTATAAGTAAAGACCATTCAATACACACAAATCTAGGGCTTCGTGGTTCTGGGTAATGATCAG[A/G]
TCTACAAATTCGTGGCATAAAACCCCTAAAAATCTCACAAATCTAGGGCTTTGCTACAACAATCACCCCCCCCCCCCCAAAAAAAAAAATTGAAACTTTA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.90%	39.50%	0.21%	1.38%	NA
All Indica	2759	47.40%	52.10%	0.25%	0.25%	NA
All Japonica	1512	83.30%	13.30%	0.13%	3.31%	NA
Aus	269	48.00%	49.80%	0.00%	2.23%	NA
Indica I	595	26.20%	73.40%	0.34%	0.00%	NA
Indica II	465	75.90%	22.80%	0.00%	1.29%	NA
Indica III	913	39.10%	60.70%	0.22%	0.00%	NA
Indica Intermediate	786	56.10%	43.40%	0.38%	0.13%	NA
Temperate Japonica	767	85.30%	13.30%	0.00%	1.43%	NA
Tropical Japonica	504	82.70%	12.90%	0.20%	4.17%	NA
Japonica Intermediate	241	78.00%	14.10%	0.41%	7.47%	NA
VI/Aromatic	96	34.40%	65.60%	0.00%	0.00%	NA
Intermediate	90	63.30%	33.30%	1.11%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1127411416	T -> DEL	N	N	silent_mutation	Average:62.097; most accessible tissue: Zhenshan97 panicle, score: 87.764	N	N	N	N
vg1127411416	T -> C	LOC_Os11g45280.1	downstream_gene_variant ; 4808.0bp to feature; MODIFIER	silent_mutation	Average:62.097; most accessible tissue: Zhenshan97 panicle, score: 87.764	N	N	N	N
vg1127411416	T -> C	LOC_Os11g45290.1	downstream_gene_variant ; 1481.0bp to feature; MODIFIER	silent_mutation	Average:62.097; most accessible tissue: Zhenshan97 panicle, score: 87.764	N	N	N	N
vg1127411416	T -> C	LOC_Os11g45280.2	downstream_gene_variant ; 4810.0bp to feature; MODIFIER	silent_mutation	Average:62.097; most accessible tissue: Zhenshan97 panicle, score: 87.764	N	N	N	N
vg1127411416	T -> C	LOC_Os11g45290.2	downstream_gene_variant ; 1423.0bp to feature; MODIFIER	silent_mutation	Average:62.097; most accessible tissue: Zhenshan97 panicle, score: 87.764	N	N	N	N
vg1127411416	T -> C	LOC_Os11g45295.1	intron_variant ; MODIFIER	silent_mutation	Average:62.097; most accessible tissue: Zhenshan97 panicle, score: 87.764	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1127411416	NA	9.25E-08	mr1014	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127411416	NA	2.91E-06	mr1185	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127411416	1.83E-06	4.90E-08	mr1185	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127411416	NA	1.86E-09	mr1191	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127411416	NA	2.17E-06	mr1269	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127411416	NA	3.37E-06	mr1269	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127411416	NA	8.88E-13	mr1644	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127411416	NA	2.98E-08	mr1644	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127411416	NA	9.14E-07	mr1835	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127411416	NA	5.24E-06	mr1975	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127411416	NA	1.54E-06	mr1180_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127411416	1.18E-08	1.71E-18	mr1191_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127411416	NA	1.44E-10	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127411416	2.49E-12	2.49E-12	mr1191_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127411416	NA	3.14E-06	mr1380_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127411416	NA	8.52E-06	mr1522_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127411416	NA	7.76E-07	mr1561_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127411416	NA	1.20E-07	mr1875_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127411416	NA	1.59E-06	mr1908_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251