\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127411416:

Variant ID: vg1127411416 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 27411416
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.72, C: 0.28, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


TAAAGTTTCAATTTTTTTTTTTGGGGGGGGGGGGGTGATTGTTGTAGCAAAGCCCTAGATTTGTGAGATTTTTAGGGGTTTTATGCCACGAATTTGTAGA[T/C]
CTGATCATTACCCAGAACCACGAAGCCCTAGATTTGTGTGTATTGAATGGTCTTTACTTATAAACTTGCAGATCTGGACATGAACAGGAATAATGAATTT

Reverse complement sequence

AAATTCATTATTCCTGTTCATGTCCAGATCTGCAAGTTTATAAGTAAAGACCATTCAATACACACAAATCTAGGGCTTCGTGGTTCTGGGTAATGATCAG[A/G]
TCTACAAATTCGTGGCATAAAACCCCTAAAAATCTCACAAATCTAGGGCTTTGCTACAACAATCACCCCCCCCCCCCCAAAAAAAAAAATTGAAACTTTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.90% 39.50% 0.21% 1.38% NA
All Indica  2759 47.40% 52.10% 0.25% 0.25% NA
All Japonica  1512 83.30% 13.30% 0.13% 3.31% NA
Aus  269 48.00% 49.80% 0.00% 2.23% NA
Indica I  595 26.20% 73.40% 0.34% 0.00% NA
Indica II  465 75.90% 22.80% 0.00% 1.29% NA
Indica III  913 39.10% 60.70% 0.22% 0.00% NA
Indica Intermediate  786 56.10% 43.40% 0.38% 0.13% NA
Temperate Japonica  767 85.30% 13.30% 0.00% 1.43% NA
Tropical Japonica  504 82.70% 12.90% 0.20% 4.17% NA
Japonica Intermediate  241 78.00% 14.10% 0.41% 7.47% NA
VI/Aromatic  96 34.40% 65.60% 0.00% 0.00% NA
Intermediate  90 63.30% 33.30% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1127411416 T -> DEL N N silent_mutation Average:62.097; most accessible tissue: Zhenshan97 panicle, score: 87.764 N N N N
vg1127411416 T -> C LOC_Os11g45280.1 downstream_gene_variant ; 4808.0bp to feature; MODIFIER silent_mutation Average:62.097; most accessible tissue: Zhenshan97 panicle, score: 87.764 N N N N
vg1127411416 T -> C LOC_Os11g45290.1 downstream_gene_variant ; 1481.0bp to feature; MODIFIER silent_mutation Average:62.097; most accessible tissue: Zhenshan97 panicle, score: 87.764 N N N N
vg1127411416 T -> C LOC_Os11g45280.2 downstream_gene_variant ; 4810.0bp to feature; MODIFIER silent_mutation Average:62.097; most accessible tissue: Zhenshan97 panicle, score: 87.764 N N N N
vg1127411416 T -> C LOC_Os11g45290.2 downstream_gene_variant ; 1423.0bp to feature; MODIFIER silent_mutation Average:62.097; most accessible tissue: Zhenshan97 panicle, score: 87.764 N N N N
vg1127411416 T -> C LOC_Os11g45295.1 intron_variant ; MODIFIER silent_mutation Average:62.097; most accessible tissue: Zhenshan97 panicle, score: 87.764 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1127411416 NA 9.25E-08 mr1014 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127411416 NA 2.91E-06 mr1185 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127411416 1.83E-06 4.90E-08 mr1185 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127411416 NA 1.86E-09 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127411416 NA 2.17E-06 mr1269 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127411416 NA 3.37E-06 mr1269 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127411416 NA 8.88E-13 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127411416 NA 2.98E-08 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127411416 NA 9.14E-07 mr1835 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127411416 NA 5.24E-06 mr1975 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127411416 NA 1.54E-06 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127411416 1.18E-08 1.71E-18 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127411416 NA 1.44E-10 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127411416 2.49E-12 2.49E-12 mr1191_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127411416 NA 3.14E-06 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127411416 NA 8.52E-06 mr1522_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127411416 NA 7.76E-07 mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127411416 NA 1.20E-07 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127411416 NA 1.59E-06 mr1908_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251