Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1127383403:

Variant ID: vg1127383403 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 27383403
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.77, A: 0.24, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:

CTGCAAGGGAGGAAGCAAGTGAAGGAGATGTATTTGAATAGGGAGGGGAAAGGAGAGGGCTGGCTTTATTTGGCGGGAAATGAGAGGTCAGGTTGTTCCC[G/A]
GACAATTTTCCCGGCAAAATAGGGGGCAATGCTGGCCGGTGACTTGCAAGTTGCAACCAACACCCCTTCATGCATTTGCCGTGAAGAAAGGAGAGGACAC

Reverse complement sequence

GTGTCCTCTCCTTTCTTCACGGCAAATGCATGAAGGGGTGTTGGTTGCAACTTGCAAGTCACCGGCCAGCATTGCCCCCTATTTTGCCGGGAAAATTGTC[C/T]
GGGAACAACCTGACCTCTCATTTCCCGCCAAATAAAGCCAGCCCTCTCCTTTCCCCTCCCTATTCAAATACATCTCCTTCACTTGCTTCCTCCCTTGCAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.30%	34.20%	0.70%	2.81%	NA
All Indica	2759	71.60%	24.10%	0.54%	3.81%	NA
All Japonica	1512	47.50%	51.60%	0.46%	0.46%	NA
Aus	269	42.80%	48.30%	4.09%	4.83%	NA
Indica I	595	44.20%	54.50%	0.17%	1.18%	NA
Indica II	465	96.60%	3.20%	0.22%	0.00%	NA
Indica III	913	78.10%	14.20%	0.44%	7.23%	NA
Indica Intermediate	786	70.00%	24.80%	1.15%	4.07%	NA
Temperate Japonica	767	50.50%	48.60%	0.65%	0.26%	NA
Tropical Japonica	504	41.30%	57.50%	0.20%	0.99%	NA
Japonica Intermediate	241	51.00%	48.50%	0.41%	0.00%	NA
VI/Aromatic	96	77.10%	15.60%	0.00%	7.29%	NA
Intermediate	90	70.00%	28.90%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1127383403	G -> A	LOC_Os11g45240.1	upstream_gene_variant ; 1664.0bp to feature; MODIFIER	silent_mutation	Average:76.612; most accessible tissue: Zhenshan97 young leaf, score: 85.542	N	N	N	N
vg1127383403	G -> A	LOC_Os11g45250.1	downstream_gene_variant ; 113.0bp to feature; MODIFIER	silent_mutation	Average:76.612; most accessible tissue: Zhenshan97 young leaf, score: 85.542	N	N	N	N
vg1127383403	G -> A	LOC_Os11g45250.2	downstream_gene_variant ; 113.0bp to feature; MODIFIER	silent_mutation	Average:76.612; most accessible tissue: Zhenshan97 young leaf, score: 85.542	N	N	N	N
vg1127383403	G -> A	LOC_Os11g45240-LOC_Os11g45250	intergenic_region ; MODIFIER	silent_mutation	Average:76.612; most accessible tissue: Zhenshan97 young leaf, score: 85.542	N	N	N	N
vg1127383403	G -> DEL	N	N	silent_mutation	Average:76.612; most accessible tissue: Zhenshan97 young leaf, score: 85.542	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1127383403	NA	8.05E-07	mr1531_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127383403	NA	1.45E-07	mr1557_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127383403	NA	7.18E-06	mr1659_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127383403	2.19E-07	2.89E-09	mr1662_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251