\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127289309:

Variant ID: vg1127289309 (JBrowse)Variation Type: INDEL
Chromosome: chr11Position: 27289309
Reference Allele: CGCTGCCTTAACTCTAlternative Allele: TGCTGCCTTAACTCT,C,CAACTCT
Primary Allele: CGCTGCCTTAACTCTSecondary Allele: TGCTGCCTTAACTCT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAAGCTTCGGAGGATCCCTGTGCCTATTACCAGGAGGGTGATGAAGACGATGGTGCTCAATAGGTCTTAGTTACGGTCGTTGCCTGTGGCAATGGCGTGC[CGCTGCCTTAACTCT/TGCTGCCTTAACTCT,C,CAACTCT]
GCTGCCTTATCTACCTCTGTTTTTGGGATGTACTCCGGACCGCTCGGTTCGATGATTTAAGACTATGCCTGCGGGCTTATGATGTAATAATTTGCACTAG

Reverse complement sequence

CTAGTGCAAATTATTACATCATAAGCCCGCAGGCATAGTCTTAAATCATCGAACCGAGCGGTCCGGAGTACATCCCAAAAACAGAGGTAGATAAGGCAGC[AGAGTTAAGGCAGCG/AGAGTTAAGGCAGCA,G,AGAGTTG]
GCACGCCATTGCCACAGGCAACGACCGTAACTAAGACCTATTGAGCACCATCGTCTTCATCACCCTCCTGGTAATAGGCACAGGGATCCTCCGAAGCTTC

Allele Frequencies:

Populations Population SizeFrequency of CGCTGCCTTAACTCT(primary allele) Frequency of TGCTGCCTTAACTCT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.00% 8.50% 2.75% 54.30% C: 0.38%
All Indica  2759 33.90% 12.20% 2.68% 50.71% C: 0.51%
All Japonica  1512 34.60% 2.80% 2.45% 59.99% C: 0.20%
Aus  269 17.10% 2.60% 4.46% 75.84% NA
Indica I  595 67.60% 23.00% 0.50% 8.91% NA
Indica II  465 21.70% 24.10% 2.58% 51.61% NA
Indica III  913 16.50% 1.60% 3.50% 76.78% C: 1.53%
Indica Intermediate  786 35.80% 9.30% 3.44% 51.53% NA
Temperate Japonica  767 53.10% 2.50% 1.04% 43.02% C: 0.39%
Tropical Japonica  504 11.50% 1.00% 3.77% 83.73% NA
Japonica Intermediate  241 24.10% 7.50% 4.15% 64.32% NA
VI/Aromatic  96 79.20% 2.10% 2.08% 16.67% NA
Intermediate  90 32.20% 16.70% 5.56% 44.44% C: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1127289309 CGCTGCCTTAACTCT -> CAACTCT LOC_Os11g45100.1 upstream_gene_variant ; 493.0bp to feature; MODIFIER N Average:61.113; most accessible tissue: Minghui63 flag leaf, score: 89.325 N N N N
vg1127289309 CGCTGCCTTAACTCT -> CAACTCT LOC_Os11g45090.1 downstream_gene_variant ; 4265.0bp to feature; MODIFIER N Average:61.113; most accessible tissue: Minghui63 flag leaf, score: 89.325 N N N N
vg1127289309 CGCTGCCTTAACTCT -> CAACTCT LOC_Os11g45090-LOC_Os11g45100 intergenic_region ; MODIFIER N Average:61.113; most accessible tissue: Minghui63 flag leaf, score: 89.325 N N N N
vg1127289309 CGCTGCCTTAACTCT -> TGCTGCCTTAACTCT LOC_Os11g45100.1 upstream_gene_variant ; 494.0bp to feature; MODIFIER silent_mutation Average:61.113; most accessible tissue: Minghui63 flag leaf, score: 89.325 N N N N
vg1127289309 CGCTGCCTTAACTCT -> TGCTGCCTTAACTCT LOC_Os11g45090.1 downstream_gene_variant ; 4264.0bp to feature; MODIFIER silent_mutation Average:61.113; most accessible tissue: Minghui63 flag leaf, score: 89.325 N N N N
vg1127289309 CGCTGCCTTAACTCT -> TGCTGCCTTAACTCT LOC_Os11g45090-LOC_Os11g45100 intergenic_region ; MODIFIER silent_mutation Average:61.113; most accessible tissue: Minghui63 flag leaf, score: 89.325 N N N N
vg1127289309 CGCTGCCTTAACTCT -> DEL N N silent_mutation Average:61.113; most accessible tissue: Minghui63 flag leaf, score: 89.325 N N N N
vg1127289309 CGCTGCCTTAACTCT -> C LOC_Os11g45100.1 upstream_gene_variant ; 493.0bp to feature; MODIFIER silent_mutation Average:61.113; most accessible tissue: Minghui63 flag leaf, score: 89.325 N N N N
vg1127289309 CGCTGCCTTAACTCT -> C LOC_Os11g45090.1 downstream_gene_variant ; 4265.0bp to feature; MODIFIER silent_mutation Average:61.113; most accessible tissue: Minghui63 flag leaf, score: 89.325 N N N N
vg1127289309 CGCTGCCTTAACTCT -> C LOC_Os11g45090-LOC_Os11g45100 intergenic_region ; MODIFIER silent_mutation Average:61.113; most accessible tissue: Minghui63 flag leaf, score: 89.325 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1127289309 CGCTG* C -0.26 -0.2 -0.22 -0.2 -0.23 -0.27
vg1127289309 CGCTG* CAACT* -0.12 -0.08 -0.16 -0.09 -0.11 -0.16
vg1127289309 CGCTG* TGCTG* 0.01 -0.01 0.0 0.0 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1127289309 4.84E-06 2.71E-07 mr1064 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127289309 NA 3.13E-06 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127289309 NA 1.09E-06 mr1534 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127289309 NA 5.26E-07 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127289309 NA 1.23E-06 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127289309 NA 4.37E-06 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127289309 NA 4.42E-06 mr1908_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251