Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127198135:

Variant ID: vg1127198135 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 27198135
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:

TCTTGTTATTTCAACTACTGTAACTATTAAGGTATCTAGTGCATCCATAGGCCATAGCTCCCAAATTAATCATGAATTATATCCATTAAGGTATCTAGTG[C/T]
ATCCATAGGCCATAGCTCCCAAATTAATCATGAATTATATCCATTACTGGGCATTAAGTCCTTAGTAAAGATTATTGAGTAAAGCTTCCTATTCAGTTCA

Reverse complement sequence

TGAACTGAATAGGAAGCTTTACTCAATAATCTTTACTAAGGACTTAATGCCCAGTAATGGATATAATTCATGATTAATTTGGGAGCTATGGCCTATGGAT[G/A]
CACTAGATACCTTAATGGATATAATTCATGATTAATTTGGGAGCTATGGCCTATGGATGCACTAGATACCTTAATAGTTACAGTAGTTGAAATAACAAGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.60%	23.30%	0.08%	0.00%	NA
All Indica	2759	67.40%	32.50%	0.07%	0.00%	NA
All Japonica	1512	92.40%	7.50%	0.13%	0.00%	NA
Aus	269	95.20%	4.80%	0.00%	0.00%	NA
Indica I	595	45.50%	54.30%	0.17%	0.00%	NA
Indica II	465	41.30%	58.70%	0.00%	0.00%	NA
Indica III	913	92.10%	7.80%	0.11%	0.00%	NA
Indica Intermediate	786	70.60%	29.40%	0.00%	0.00%	NA
Temperate Japonica	767	97.70%	2.10%	0.26%	0.00%	NA
Tropical Japonica	504	88.30%	11.70%	0.00%	0.00%	NA
Japonica Intermediate	241	84.20%	15.80%	0.00%	0.00%	NA
VI/Aromatic	96	37.50%	62.50%	0.00%	0.00%	NA
Intermediate	90	78.90%	21.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1127198135	C -> T	LOC_Os11g44930.1	downstream_gene_variant ; 247.0bp to feature; MODIFIER	silent_mutation	Average:53.821; most accessible tissue: Callus, score: 75.286	N	N	N	N
vg1127198135	C -> T	LOC_Os11g44940.1	downstream_gene_variant ; 2168.0bp to feature; MODIFIER	silent_mutation	Average:53.821; most accessible tissue: Callus, score: 75.286	N	N	N	N
vg1127198135	C -> T	LOC_Os11g44940.2	downstream_gene_variant ; 2171.0bp to feature; MODIFIER	silent_mutation	Average:53.821; most accessible tissue: Callus, score: 75.286	N	N	N	N
vg1127198135	C -> T	LOC_Os11g44920-LOC_Os11g44930	intergenic_region ; MODIFIER	silent_mutation	Average:53.821; most accessible tissue: Callus, score: 75.286	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1127198135	1.91E-06	8.58E-13	mr1133	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127198135	NA	3.34E-06	mr1191	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127198135	NA	4.22E-07	mr1561	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127198135	7.59E-06	NA	mr1644	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127198135	NA	2.68E-10	mr1644	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127198135	NA	8.35E-07	mr1667	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127198135	1.67E-06	NA	mr1133_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127198135	NA	1.78E-11	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127198135	NA	7.92E-09	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127198135	NA	1.48E-09	mr1380_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127198135	NA	1.72E-06	mr1404_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127198135	NA	1.48E-10	mr1561_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127198135	NA	3.09E-06	mr1620_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127198135	NA	2.73E-08	mr1667_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127198135	NA	1.61E-08	mr1875_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127198135	NA	5.45E-10	mr1908_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127198135	NA	5.45E-06	mr1929_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127198135	NA	5.43E-06	mr1996_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127198135	NA	1.04E-08	mr1996_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251