\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127198135:

Variant ID: vg1127198135 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 27198135
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


TCTTGTTATTTCAACTACTGTAACTATTAAGGTATCTAGTGCATCCATAGGCCATAGCTCCCAAATTAATCATGAATTATATCCATTAAGGTATCTAGTG[C/T]
ATCCATAGGCCATAGCTCCCAAATTAATCATGAATTATATCCATTACTGGGCATTAAGTCCTTAGTAAAGATTATTGAGTAAAGCTTCCTATTCAGTTCA

Reverse complement sequence

TGAACTGAATAGGAAGCTTTACTCAATAATCTTTACTAAGGACTTAATGCCCAGTAATGGATATAATTCATGATTAATTTGGGAGCTATGGCCTATGGAT[G/A]
CACTAGATACCTTAATGGATATAATTCATGATTAATTTGGGAGCTATGGCCTATGGATGCACTAGATACCTTAATAGTTACAGTAGTTGAAATAACAAGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.60% 23.30% 0.08% 0.00% NA
All Indica  2759 67.40% 32.50% 0.07% 0.00% NA
All Japonica  1512 92.40% 7.50% 0.13% 0.00% NA
Aus  269 95.20% 4.80% 0.00% 0.00% NA
Indica I  595 45.50% 54.30% 0.17% 0.00% NA
Indica II  465 41.30% 58.70% 0.00% 0.00% NA
Indica III  913 92.10% 7.80% 0.11% 0.00% NA
Indica Intermediate  786 70.60% 29.40% 0.00% 0.00% NA
Temperate Japonica  767 97.70% 2.10% 0.26% 0.00% NA
Tropical Japonica  504 88.30% 11.70% 0.00% 0.00% NA
Japonica Intermediate  241 84.20% 15.80% 0.00% 0.00% NA
VI/Aromatic  96 37.50% 62.50% 0.00% 0.00% NA
Intermediate  90 78.90% 21.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1127198135 C -> T LOC_Os11g44930.1 downstream_gene_variant ; 247.0bp to feature; MODIFIER silent_mutation Average:53.821; most accessible tissue: Callus, score: 75.286 N N N N
vg1127198135 C -> T LOC_Os11g44940.1 downstream_gene_variant ; 2168.0bp to feature; MODIFIER silent_mutation Average:53.821; most accessible tissue: Callus, score: 75.286 N N N N
vg1127198135 C -> T LOC_Os11g44940.2 downstream_gene_variant ; 2171.0bp to feature; MODIFIER silent_mutation Average:53.821; most accessible tissue: Callus, score: 75.286 N N N N
vg1127198135 C -> T LOC_Os11g44920-LOC_Os11g44930 intergenic_region ; MODIFIER silent_mutation Average:53.821; most accessible tissue: Callus, score: 75.286 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1127198135 1.91E-06 8.58E-13 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127198135 NA 3.34E-06 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127198135 NA 4.22E-07 mr1561 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127198135 7.59E-06 NA mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127198135 NA 2.68E-10 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127198135 NA 8.35E-07 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127198135 1.67E-06 NA mr1133_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127198135 NA 1.78E-11 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127198135 NA 7.92E-09 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127198135 NA 1.48E-09 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127198135 NA 1.72E-06 mr1404_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127198135 NA 1.48E-10 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127198135 NA 3.09E-06 mr1620_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127198135 NA 2.73E-08 mr1667_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127198135 NA 1.61E-08 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127198135 NA 5.45E-10 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127198135 NA 5.45E-06 mr1929_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127198135 NA 5.43E-06 mr1996_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127198135 NA 1.04E-08 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251