\
| Variant ID: vg1127125428 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 27125428 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 245. )
TCCATAAAGATAATTTTAAGTTTAATTGTGATTAGGATGAAAAAAAAAGAAAGGAGCAGAGGTAGCGTACAATACGTGTGTGCTGCACGGAGGTGCGGAC[A/G]
TTTATAGGTTTTGGTTTTTTTAAAGATACATCTAACATTCTAAAATAATCGGTCCACCGATTTAAAGAAAAATTGATGGTCAGATTTCTTTATTTTATTA
TAATAAAATAAAGAAATCTGACCATCAATTTTTCTTTAAATCGGTGGACCGATTATTTTAGAATGTTAGATGTATCTTTAAAAAAACCAAAACCTATAAA[T/C]
GTCCGCACCTCCGTGCAGCACACACGTATTGTACGCTACCTCTGCTCCTTTCTTTTTTTTTCATCCTAATCACAATTAAACTTAAAATTATCTTTATGGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.80% | 1.20% | 1.04% | 2.92% | NA |
| All Indica | 2759 | 93.40% | 1.90% | 1.38% | 3.33% | NA |
| All Japonica | 1512 | 99.20% | 0.10% | 0.33% | 0.40% | NA |
| Aus | 269 | 98.50% | 0.00% | 0.00% | 1.49% | NA |
| Indica I | 595 | 96.10% | 0.30% | 0.34% | 3.19% | NA |
| Indica II | 465 | 90.30% | 5.20% | 2.15% | 2.37% | NA |
| Indica III | 913 | 95.40% | 1.30% | 1.42% | 1.86% | NA |
| Indica Intermediate | 786 | 90.70% | 1.90% | 1.65% | 5.73% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 98.60% | 0.00% | 0.99% | 0.40% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.40% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 57.30% | 4.20% | 5.21% | 33.33% | NA |
| Intermediate | 90 | 94.40% | 0.00% | 1.11% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1127125428 | A -> DEL | N | N | silent_mutation | Average:48.912; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg1127125428 | A -> G | LOC_Os11g44820.1 | downstream_gene_variant ; 1652.0bp to feature; MODIFIER | silent_mutation | Average:48.912; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg1127125428 | A -> G | LOC_Os11g44830.1 | downstream_gene_variant ; 3490.0bp to feature; MODIFIER | silent_mutation | Average:48.912; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg1127125428 | A -> G | LOC_Os11g44820-LOC_Os11g44830 | intergenic_region ; MODIFIER | silent_mutation | Average:48.912; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1127125428 | 2.09E-06 | 2.09E-06 | mr1275 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127125428 | 3.27E-06 | 3.27E-06 | mr1315 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127125428 | 1.56E-06 | 1.56E-06 | mr1507 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127125428 | 3.81E-06 | 3.81E-06 | mr1605 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127125428 | 3.59E-06 | 3.59E-06 | mr1809 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |