\
| Variant ID: vg1127031755 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 27031755 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, A: 0.02, others allele: 0.00, population size: 99. )
GAAAGACCATCTTGTTTATACAAATGACAAAATTACAGCAGAGGATGGTACAGCTATCAAAATTGCCATATTTAGGGATAATAAGATAGTTACTGCCGGC[C/A]
AACTTTCTTCAGCAAGAATTGAAATTTTTTTTTTGAACGACTCGCACGAGACGGTGCGAAGTTCTATTGATAGAGCAGGAAAAAATTACAAGGTTACAAC
GTTGTAACCTTGTAATTTTTTCCTGCTCTATCAATAGAACTTCGCACCGTCTCGTGCGAGTCGTTCAAAAAAAAAATTTCAATTCTTGCTGAAGAAAGTT[G/T]
GCCGGCAGTAACTATCTTATTATCCCTAAATATGGCAATTTTGATAGCTGTACCATCCTCTGCTGTAATTTTGTCATTTGTATAAACAAGATGGTCTTTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 77.50% | 21.10% | 1.33% | 0.00% | NA |
| All Indica | 2759 | 68.50% | 29.80% | 1.74% | 0.00% | NA |
| All Japonica | 1512 | 92.40% | 6.70% | 0.86% | 0.00% | NA |
| Aus | 269 | 98.10% | 1.50% | 0.37% | 0.00% | NA |
| Indica I | 595 | 87.70% | 11.80% | 0.50% | 0.00% | NA |
| Indica II | 465 | 40.20% | 59.40% | 0.43% | 0.00% | NA |
| Indica III | 913 | 72.30% | 25.50% | 2.19% | 0.00% | NA |
| Indica Intermediate | 786 | 66.30% | 30.80% | 2.93% | 0.00% | NA |
| Temperate Japonica | 767 | 86.60% | 11.70% | 1.69% | 0.00% | NA |
| Tropical Japonica | 504 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 39.60% | 59.40% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1127031755 | C -> A | LOC_Os11g44700.1 | missense_variant ; p.Gln235Lys; MODERATE | nonsynonymous_codon ; Q235K | Average:48.848; most accessible tissue: Zhenshan97 flower, score: 69.089 | benign |
-0.199 |
TOLERATED | 0.34 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1127031755 | NA | 2.51E-07 | mr1644 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127031755 | NA | 3.42E-09 | mr1191_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127031755 | 1.03E-06 | 8.06E-11 | mr1380_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127031755 | 2.95E-07 | 3.67E-11 | mr1561_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127031755 | NA | 8.65E-10 | mr1875_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127031755 | 2.19E-06 | 3.53E-10 | mr1908_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127031755 | 6.19E-06 | 1.93E-09 | mr1996_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |