\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127031755:

Variant ID: vg1127031755 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 27031755
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, A: 0.02, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


GAAAGACCATCTTGTTTATACAAATGACAAAATTACAGCAGAGGATGGTACAGCTATCAAAATTGCCATATTTAGGGATAATAAGATAGTTACTGCCGGC[C/A]
AACTTTCTTCAGCAAGAATTGAAATTTTTTTTTTGAACGACTCGCACGAGACGGTGCGAAGTTCTATTGATAGAGCAGGAAAAAATTACAAGGTTACAAC

Reverse complement sequence

GTTGTAACCTTGTAATTTTTTCCTGCTCTATCAATAGAACTTCGCACCGTCTCGTGCGAGTCGTTCAAAAAAAAAATTTCAATTCTTGCTGAAGAAAGTT[G/T]
GCCGGCAGTAACTATCTTATTATCCCTAAATATGGCAATTTTGATAGCTGTACCATCCTCTGCTGTAATTTTGTCATTTGTATAAACAAGATGGTCTTTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.50% 21.10% 1.33% 0.00% NA
All Indica  2759 68.50% 29.80% 1.74% 0.00% NA
All Japonica  1512 92.40% 6.70% 0.86% 0.00% NA
Aus  269 98.10% 1.50% 0.37% 0.00% NA
Indica I  595 87.70% 11.80% 0.50% 0.00% NA
Indica II  465 40.20% 59.40% 0.43% 0.00% NA
Indica III  913 72.30% 25.50% 2.19% 0.00% NA
Indica Intermediate  786 66.30% 30.80% 2.93% 0.00% NA
Temperate Japonica  767 86.60% 11.70% 1.69% 0.00% NA
Tropical Japonica  504 98.80% 1.20% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 2.50% 0.00% 0.00% NA
VI/Aromatic  96 39.60% 59.40% 1.04% 0.00% NA
Intermediate  90 83.30% 16.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1127031755 C -> A LOC_Os11g44700.1 missense_variant ; p.Gln235Lys; MODERATE nonsynonymous_codon ; Q235K Average:48.848; most accessible tissue: Zhenshan97 flower, score: 69.089 benign -0.199 TOLERATED 0.34

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1127031755 NA 2.51E-07 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127031755 NA 3.42E-09 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127031755 1.03E-06 8.06E-11 mr1380_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127031755 2.95E-07 3.67E-11 mr1561_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127031755 NA 8.65E-10 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127031755 2.19E-06 3.53E-10 mr1908_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127031755 6.19E-06 1.93E-09 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251