\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126919326:

Variant ID: vg1126919326 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 26919326
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 35. )

Flanking Sequence (100 bp) in Reference Genome:


GAATTTGACCTAGAGTTTCACAGGAATTTGAAAGGAAATTCTAATATAGGATTTGAGATCCTTTTGGCACAAAATCAACTAAGAACCAAATTAACTCCAA[T/A]
TTTTAAATGACAAACTTTTTTAAATAAAAGCACATAAAATACGGGTGCTACAGTTGACGACGCAGGGGAGGAGGAGGAGGAGGACGGAGATTCCTGTCGC

Reverse complement sequence

GCGACAGGAATCTCCGTCCTCCTCCTCCTCCTCCCCTGCGTCGTCAACTGTAGCACCCGTATTTTATGTGCTTTTATTTAAAAAAGTTTGTCATTTAAAA[A/T]
TTGGAGTTAATTTGGTTCTTAGTTGATTTTGTGCCAAAAGGATCTCAAATCCTATATTAGAATTTCCTTTCAAATTCCTGTGAAACTCTAGGTCAAATTC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.20% 3.40% 26.62% 24.76% NA
All Indica  2759 49.90% 3.30% 35.77% 10.95% NA
All Japonica  1512 39.40% 3.80% 9.33% 47.49% NA
Aus  269 45.70% 1.10% 32.71% 20.45% NA
Indica I  595 38.80% 3.00% 44.71% 13.45% NA
Indica II  465 35.50% 4.70% 36.99% 22.80% NA
Indica III  913 61.70% 3.10% 31.98% 3.29% NA
Indica Intermediate  786 53.30% 3.10% 32.70% 10.94% NA
Temperate Japonica  767 65.80% 0.40% 6.26% 27.51% NA
Tropical Japonica  504 6.90% 9.90% 12.30% 70.83% NA
Japonica Intermediate  241 22.80% 2.10% 12.86% 62.24% NA
VI/Aromatic  96 12.50% 2.10% 13.54% 71.88% NA
Intermediate  90 33.30% 5.60% 32.22% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1126919326 T -> A LOC_Os11g44510.1 upstream_gene_variant ; 2091.0bp to feature; MODIFIER silent_mutation Average:57.291; most accessible tissue: Zhenshan97 root, score: 89.721 N N N N
vg1126919326 T -> A LOC_Os11g44520.1 upstream_gene_variant ; 4390.0bp to feature; MODIFIER silent_mutation Average:57.291; most accessible tissue: Zhenshan97 root, score: 89.721 N N N N
vg1126919326 T -> A LOC_Os11g44490.1 downstream_gene_variant ; 4443.0bp to feature; MODIFIER silent_mutation Average:57.291; most accessible tissue: Zhenshan97 root, score: 89.721 N N N N
vg1126919326 T -> A LOC_Os11g44500.1 downstream_gene_variant ; 939.0bp to feature; MODIFIER silent_mutation Average:57.291; most accessible tissue: Zhenshan97 root, score: 89.721 N N N N
vg1126919326 T -> A LOC_Os11g44500-LOC_Os11g44510 intergenic_region ; MODIFIER silent_mutation Average:57.291; most accessible tissue: Zhenshan97 root, score: 89.721 N N N N
vg1126919326 T -> DEL N N silent_mutation Average:57.291; most accessible tissue: Zhenshan97 root, score: 89.721 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1126919326 NA 3.22E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126919326 3.99E-06 6.31E-06 mr1928 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126919326 NA 5.04E-09 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251