\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126876944:

Variant ID: vg1126876944 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 26876944
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, T: 0.01, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


CTAAATGTTTGTTTTGAACTTGTAACAACAGTACAACGCAATCAAGAAAAACACATACAAAGATAAAATCCATACCCCTATCCCTATGCCAGTTTATTTC[G/T]
ATCAATTTGACTTTGAGCAAACCTGATGATAGAGCTTTAGTGAAAATCACAGCAAGCCCAAGCCATCAAAGACGGTCCACTACAGACATATGCATCTCAA

Reverse complement sequence

TTGAGATGCATATGTCTGTAGTGGACCGTCTTTGATGGCTTGGGCTTGCTGTGATTTTCACTAAAGCTCTATCATCAGGTTTGCTCAAAGTCAAATTGAT[C/A]
GAAATAAACTGGCATAGGGATAGGGGTATGGATTTTATCTTTGTATGTGTTTTTCTTGATTGCGTTGTACTGTTGTTACAAGTTCAAAACAAACATTTAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.40% 12.10% 2.18% 23.32% NA
All Indica  2759 41.80% 20.40% 1.88% 35.96% NA
All Japonica  1512 94.00% 0.10% 1.79% 4.03% NA
Aus  269 79.20% 0.40% 6.32% 14.13% NA
Indica I  595 48.10% 28.70% 1.68% 21.51% NA
Indica II  465 42.60% 41.90% 0.65% 14.84% NA
Indica III  913 36.10% 5.40% 2.30% 56.19% NA
Indica Intermediate  786 43.00% 18.80% 2.29% 35.88% NA
Temperate Japonica  767 96.00% 0.00% 0.26% 3.78% NA
Tropical Japonica  504 93.80% 0.20% 0.99% 4.96% NA
Japonica Intermediate  241 88.40% 0.40% 8.30% 2.90% NA
VI/Aromatic  96 94.80% 0.00% 5.21% 0.00% NA
Intermediate  90 77.80% 7.80% 2.22% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1126876944 G -> T LOC_Os11g44415.1 upstream_gene_variant ; 3031.0bp to feature; MODIFIER silent_mutation Average:61.314; most accessible tissue: Minghui63 root, score: 97.787 N N N N
vg1126876944 G -> T LOC_Os11g44420.1 upstream_gene_variant ; 827.0bp to feature; MODIFIER silent_mutation Average:61.314; most accessible tissue: Minghui63 root, score: 97.787 N N N N
vg1126876944 G -> T LOC_Os11g44440.1 upstream_gene_variant ; 4224.0bp to feature; MODIFIER silent_mutation Average:61.314; most accessible tissue: Minghui63 root, score: 97.787 N N N N
vg1126876944 G -> T LOC_Os11g44430.1 downstream_gene_variant ; 930.0bp to feature; MODIFIER silent_mutation Average:61.314; most accessible tissue: Minghui63 root, score: 97.787 N N N N
vg1126876944 G -> T LOC_Os11g44420-LOC_Os11g44430 intergenic_region ; MODIFIER silent_mutation Average:61.314; most accessible tissue: Minghui63 root, score: 97.787 N N N N
vg1126876944 G -> DEL N N silent_mutation Average:61.314; most accessible tissue: Minghui63 root, score: 97.787 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1126876944 G T 0.01 -0.01 0.0 -0.01 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1126876944 NA 4.45E-06 mr1122 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126876944 NA 7.76E-06 mr1285 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126876944 NA 1.44E-09 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126876944 3.95E-07 3.95E-07 mr1299 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126876944 NA 1.46E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126876944 6.93E-06 6.93E-06 mr1345 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126876944 NA 7.40E-06 mr1376 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126876944 NA 7.40E-06 mr1431 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126876944 NA 8.19E-06 mr1594 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126876944 NA 8.91E-06 mr1634 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126876944 NA 3.00E-09 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126876944 9.45E-07 9.45E-07 mr1700 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126876944 NA 1.57E-08 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126876944 4.04E-07 4.04E-07 mr1756 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126876944 NA 6.06E-06 mr1775 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126876944 NA 9.62E-06 mr1928 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126876944 6.73E-06 6.73E-06 mr1972 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126876944 NA 9.85E-06 mr1976 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126876944 NA 7.78E-06 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251