| Variant ID: vg1126820959 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 26820959 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CATCGGAGATGAAGATGGGATCTAAGCGAAATCGAAGATAAGGGTGTTGTGGAAACAGAGCAAGAATCGGCTGCAATCTAAATCGGCTACGGTTAGGATC[G/A]
GCAGAGTTCGAGTCGGACGGGGCTAGCCGATACAGCCGATTCCGGCAATACGATTTGGTGTATGTCATCGGGTTGAGTTAATATGCTTCATGGTGGTTGC
GCAACCACCATGAAGCATATTAACTCAACCCGATGACATACACCAAATCGTATTGCCGGAATCGGCTGTATCGGCTAGCCCCGTCCGACTCGAACTCTGC[C/T]
GATCCTAACCGTAGCCGATTTAGATTGCAGCCGATTCTTGCTCTGTTTCCACAACACCCTTATCTTCGATTTCGCTTAGATCCCATCTTCATCTCCGATG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.60% | 4.40% | 5.27% | 9.78% | NA |
| All Indica | 2759 | 75.50% | 5.00% | 8.08% | 11.38% | NA |
| All Japonica | 1512 | 88.80% | 3.20% | 0.79% | 7.21% | NA |
| Aus | 269 | 79.60% | 4.10% | 4.46% | 11.90% | NA |
| Indica I | 595 | 91.90% | 0.50% | 1.18% | 6.39% | NA |
| Indica II | 465 | 65.60% | 0.90% | 10.97% | 22.58% | NA |
| Indica III | 913 | 71.50% | 10.40% | 11.94% | 6.13% | NA |
| Indica Intermediate | 786 | 73.50% | 4.70% | 7.12% | 14.63% | NA |
| Temperate Japonica | 767 | 89.70% | 1.20% | 1.30% | 7.82% | NA |
| Tropical Japonica | 504 | 92.50% | 2.60% | 0.20% | 4.76% | NA |
| Japonica Intermediate | 241 | 78.40% | 10.80% | 0.41% | 10.37% | NA |
| VI/Aromatic | 96 | 91.70% | 7.30% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 88.90% | 2.20% | 2.22% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1126820959 | G -> A | LOC_Os11g44360.1 | downstream_gene_variant ; 4301.0bp to feature; MODIFIER | silent_mutation | Average:44.638; most accessible tissue: Zhenshan97 young leaf, score: 57.78 | N | N | N | N |
| vg1126820959 | G -> A | LOC_Os11g44370.1 | downstream_gene_variant ; 1582.0bp to feature; MODIFIER | silent_mutation | Average:44.638; most accessible tissue: Zhenshan97 young leaf, score: 57.78 | N | N | N | N |
| vg1126820959 | G -> A | LOC_Os11g44360-LOC_Os11g44370 | intergenic_region ; MODIFIER | silent_mutation | Average:44.638; most accessible tissue: Zhenshan97 young leaf, score: 57.78 | N | N | N | N |
| vg1126820959 | G -> DEL | N | N | silent_mutation | Average:44.638; most accessible tissue: Zhenshan97 young leaf, score: 57.78 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1126820959 | NA | 3.26E-06 | mr1114 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126820959 | NA | 1.56E-06 | mr1123 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126820959 | 4.75E-06 | 4.81E-06 | mr1150 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126820959 | 7.73E-06 | 5.60E-07 | mr1242 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126820959 | NA | 5.35E-06 | mr1247 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126820959 | 6.63E-06 | 6.89E-07 | mr1936 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |