\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126694376:

Variant ID: vg1126694376 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 26694376
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


GGATCAAGTTCCTTGAGCTTTGCTCCCGGATCGGGATGGCTCAACTTTCCCACAAGACGGCGCACAAGACTTAGGGGGAGAATGTAGGAATAAGTCTTGG[T/C]
TGGTTGGTCTTGGTCTTGTGGTGCCTTTTCCTGCTTTTCAGCTTTCTAGGACAGCATCTCTACTTTCAGTTTGGATGCTCTAGGACAGTTAGGACAGCAG

Reverse complement sequence

CTGCTGTCCTAACTGTCCTAGAGCATCCAAACTGAAAGTAGAGATGCTGTCCTAGAAAGCTGAAAAGCAGGAAAAGGCACCACAAGACCAAGACCAACCA[A/G]
CCAAGACTTATTCCTACATTCTCCCCCTAAGTCTTGTGCGCCGTCTTGTGGGAAAGTTGAGCCATCCCGATCCGGGAGCAAAGCTCAAGGAACTTGATCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.70% 3.10% 8.10% 35.12% NA
All Indica  2759 59.80% 0.50% 8.99% 30.66% NA
All Japonica  1512 49.90% 7.80% 5.29% 36.97% NA
Aus  269 26.40% 2.20% 10.78% 60.59% NA
Indica I  595 75.80% 0.20% 5.04% 18.99% NA
Indica II  465 61.50% 0.20% 10.75% 27.53% NA
Indica III  913 47.80% 1.00% 9.53% 41.73% NA
Indica Intermediate  786 60.70% 0.50% 10.31% 28.50% NA
Temperate Japonica  767 79.90% 3.30% 3.39% 13.43% NA
Tropical Japonica  504 12.90% 13.90% 8.33% 64.88% NA
Japonica Intermediate  241 32.00% 9.50% 4.98% 53.53% NA
VI/Aromatic  96 15.60% 1.00% 15.62% 67.71% NA
Intermediate  90 52.20% 5.60% 12.22% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1126694376 T -> DEL N N silent_mutation Average:32.731; most accessible tissue: Minghui63 flag leaf, score: 67.635 N N N N
vg1126694376 T -> C LOC_Os11g44210.1 upstream_gene_variant ; 4667.0bp to feature; MODIFIER silent_mutation Average:32.731; most accessible tissue: Minghui63 flag leaf, score: 67.635 N N N N
vg1126694376 T -> C LOC_Os11g44190.1 downstream_gene_variant ; 27.0bp to feature; MODIFIER silent_mutation Average:32.731; most accessible tissue: Minghui63 flag leaf, score: 67.635 N N N N
vg1126694376 T -> C LOC_Os11g44200.1 downstream_gene_variant ; 2611.0bp to feature; MODIFIER silent_mutation Average:32.731; most accessible tissue: Minghui63 flag leaf, score: 67.635 N N N N
vg1126694376 T -> C LOC_Os11g44190-LOC_Os11g44200 intergenic_region ; MODIFIER silent_mutation Average:32.731; most accessible tissue: Minghui63 flag leaf, score: 67.635 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1126694376 3.92E-06 2.54E-07 mr1148 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126694376 6.82E-07 2.26E-07 mr1184 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126694376 8.79E-06 5.99E-07 mr1195 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126694376 NA 5.63E-07 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126694376 NA 1.57E-06 mr1254 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126694376 NA 9.30E-06 mr1263 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126694376 4.65E-06 4.65E-06 mr1360 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126694376 4.72E-06 4.72E-06 mr1360 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126694376 4.32E-06 4.32E-06 mr1366 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126694376 NA 8.15E-06 mr1425 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126694376 NA 8.80E-06 mr1427 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126694376 NA 9.30E-06 mr1451 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126694376 7.33E-06 7.33E-06 mr1576 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126694376 8.17E-06 8.17E-06 mr1752 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126694376 NA 5.06E-06 mr1807 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126694376 NA 9.13E-06 mr1808 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126694376 8.87E-07 4.22E-08 mr1839 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126694376 NA 1.73E-08 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126694376 NA 4.83E-06 mr1906 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126694376 NA 2.59E-06 mr1921 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126694376 5.40E-07 5.40E-07 mr1947 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126694376 NA 3.90E-08 mr1109_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126694376 NA 1.46E-08 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126694376 NA 6.69E-07 mr1251_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126694376 NA 3.68E-07 mr1253_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126694376 NA 7.12E-07 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126694376 NA 7.39E-09 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126694376 NA 2.36E-07 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126694376 NA 2.76E-06 mr1377_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126694376 NA 6.97E-06 mr1423_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126694376 NA 5.64E-07 mr1435_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126694376 NA 6.20E-08 mr1599_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126694376 NA 2.58E-06 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126694376 NA 2.36E-06 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251