\
| Variant ID: vg1126447322 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 26447322 |
| Reference Allele: G | Alternative Allele: A,T |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.65, A: 0.35, others allele: 0.00, population size: 99. )
GGACTCTAGACTCGTCTTTTAATATTTCTTTTTTTAAAGTCCGGATTTTCTGTAAATTATATTTCTATATAGACTCTATGCTCTTCTTCCAATATTATTT[G/A,T]
TTTTTATTTCTGAATTTTTATTATTTTTAATTGTATTTCTATGTGGACTCTAAACTCATCTTTCAATATTCTTTAATTTTTAATTTCGAATTTCAGTTAT
ATAACTGAAATTCGAAATTAAAAATTAAAGAATATTGAAAGATGAGTTTAGAGTCCACATAGAAATACAATTAAAAATAATAAAAATTCAGAAATAAAAA[C/T,A]
AAATAATATTGGAAGAAGAGCATAGAGTCTATATAGAAATATAATTTACAGAAAATCCGGACTTTAAAAAAAGAAATATTAAAAGACGAGTCTAGAGTCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.20% | 45.20% | 0.93% | 0.63% | T: 0.08% |
| All Indica | 2759 | 29.20% | 68.50% | 1.09% | 1.05% | T: 0.14% |
| All Japonica | 1512 | 92.30% | 7.50% | 0.20% | 0.00% | NA |
| Aus | 269 | 61.00% | 36.10% | 2.97% | 0.00% | NA |
| Indica I | 595 | 50.90% | 48.60% | 0.34% | 0.17% | NA |
| Indica II | 465 | 26.90% | 68.60% | 1.08% | 3.44% | NA |
| Indica III | 913 | 13.90% | 85.00% | 0.66% | 0.22% | T: 0.22% |
| Indica Intermediate | 786 | 31.80% | 64.50% | 2.16% | 1.27% | T: 0.25% |
| Temperate Japonica | 767 | 97.00% | 2.60% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 86.30% | 13.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 89.60% | 10.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 66.70% | 28.90% | 3.33% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1126447322 | G -> T | LOC_Os11g43780.1 | upstream_gene_variant ; 373.0bp to feature; MODIFIER | silent_mutation | Average:16.957; most accessible tissue: Minghui63 root, score: 25.504 | N | N | N | N |
| vg1126447322 | G -> T | LOC_Os11g43770.1 | downstream_gene_variant ; 2847.0bp to feature; MODIFIER | silent_mutation | Average:16.957; most accessible tissue: Minghui63 root, score: 25.504 | N | N | N | N |
| vg1126447322 | G -> T | LOC_Os11g43780-LOC_Os11g43790 | intergenic_region ; MODIFIER | silent_mutation | Average:16.957; most accessible tissue: Minghui63 root, score: 25.504 | N | N | N | N |
| vg1126447322 | G -> A | LOC_Os11g43780.1 | upstream_gene_variant ; 373.0bp to feature; MODIFIER | silent_mutation | Average:16.957; most accessible tissue: Minghui63 root, score: 25.504 | N | N | N | N |
| vg1126447322 | G -> A | LOC_Os11g43770.1 | downstream_gene_variant ; 2847.0bp to feature; MODIFIER | silent_mutation | Average:16.957; most accessible tissue: Minghui63 root, score: 25.504 | N | N | N | N |
| vg1126447322 | G -> A | LOC_Os11g43780-LOC_Os11g43790 | intergenic_region ; MODIFIER | silent_mutation | Average:16.957; most accessible tissue: Minghui63 root, score: 25.504 | N | N | N | N |
| vg1126447322 | G -> DEL | N | N | silent_mutation | Average:16.957; most accessible tissue: Minghui63 root, score: 25.504 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1126447322 | NA | 1.21E-06 | mr1121 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126447322 | NA | 7.35E-08 | mr1191 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126447322 | NA | 6.54E-08 | mr1644 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126447322 | 3.77E-06 | NA | mr1884 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126447322 | 1.76E-06 | 9.77E-14 | mr1191_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126447322 | NA | 2.93E-07 | mr1380_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126447322 | NA | 2.69E-06 | mr1561_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126447322 | NA | 3.29E-07 | mr1875_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126447322 | NA | 1.87E-06 | mr1908_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |