\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126447322:

Variant ID: vg1126447322 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 26447322
Reference Allele: GAlternative Allele: A,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.65, A: 0.35, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


GGACTCTAGACTCGTCTTTTAATATTTCTTTTTTTAAAGTCCGGATTTTCTGTAAATTATATTTCTATATAGACTCTATGCTCTTCTTCCAATATTATTT[G/A,T]
TTTTTATTTCTGAATTTTTATTATTTTTAATTGTATTTCTATGTGGACTCTAAACTCATCTTTCAATATTCTTTAATTTTTAATTTCGAATTTCAGTTAT

Reverse complement sequence

ATAACTGAAATTCGAAATTAAAAATTAAAGAATATTGAAAGATGAGTTTAGAGTCCACATAGAAATACAATTAAAAATAATAAAAATTCAGAAATAAAAA[C/T,A]
AAATAATATTGGAAGAAGAGCATAGAGTCTATATAGAAATATAATTTACAGAAAATCCGGACTTTAAAAAAAGAAATATTAAAAGACGAGTCTAGAGTCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.20% 45.20% 0.93% 0.63% T: 0.08%
All Indica  2759 29.20% 68.50% 1.09% 1.05% T: 0.14%
All Japonica  1512 92.30% 7.50% 0.20% 0.00% NA
Aus  269 61.00% 36.10% 2.97% 0.00% NA
Indica I  595 50.90% 48.60% 0.34% 0.17% NA
Indica II  465 26.90% 68.60% 1.08% 3.44% NA
Indica III  913 13.90% 85.00% 0.66% 0.22% T: 0.22%
Indica Intermediate  786 31.80% 64.50% 2.16% 1.27% T: 0.25%
Temperate Japonica  767 97.00% 2.60% 0.39% 0.00% NA
Tropical Japonica  504 86.30% 13.70% 0.00% 0.00% NA
Japonica Intermediate  241 89.60% 10.40% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 66.70% 28.90% 3.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1126447322 G -> T LOC_Os11g43780.1 upstream_gene_variant ; 373.0bp to feature; MODIFIER silent_mutation Average:16.957; most accessible tissue: Minghui63 root, score: 25.504 N N N N
vg1126447322 G -> T LOC_Os11g43770.1 downstream_gene_variant ; 2847.0bp to feature; MODIFIER silent_mutation Average:16.957; most accessible tissue: Minghui63 root, score: 25.504 N N N N
vg1126447322 G -> T LOC_Os11g43780-LOC_Os11g43790 intergenic_region ; MODIFIER silent_mutation Average:16.957; most accessible tissue: Minghui63 root, score: 25.504 N N N N
vg1126447322 G -> A LOC_Os11g43780.1 upstream_gene_variant ; 373.0bp to feature; MODIFIER silent_mutation Average:16.957; most accessible tissue: Minghui63 root, score: 25.504 N N N N
vg1126447322 G -> A LOC_Os11g43770.1 downstream_gene_variant ; 2847.0bp to feature; MODIFIER silent_mutation Average:16.957; most accessible tissue: Minghui63 root, score: 25.504 N N N N
vg1126447322 G -> A LOC_Os11g43780-LOC_Os11g43790 intergenic_region ; MODIFIER silent_mutation Average:16.957; most accessible tissue: Minghui63 root, score: 25.504 N N N N
vg1126447322 G -> DEL N N silent_mutation Average:16.957; most accessible tissue: Minghui63 root, score: 25.504 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1126447322 NA 1.21E-06 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126447322 NA 7.35E-08 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126447322 NA 6.54E-08 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126447322 3.77E-06 NA mr1884 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126447322 1.76E-06 9.77E-14 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126447322 NA 2.93E-07 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126447322 NA 2.69E-06 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126447322 NA 3.29E-07 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126447322 NA 1.87E-06 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251