\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126445759:

Variant ID: vg1126445759 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 26445759
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, T: 0.10, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


TCAACGACCAAAGTTTGAGGTATTCAAGTATTGCCTGAGTCCCAAGCGCGCCTCTTATGTCCTTGATCCATCTACGGTTAGACAGCGCTTCAGCCACCGT[T/C]
CGGCGCTTCCGGATACGAGTAGAGACATGATCGTAGATGGAGGGTGCAATAGCTCGGATGGTTCCTCCTTGCAACCAATTGTCCTCCCAGAAAAGGATTG

Reverse complement sequence

CAATCCTTTTCTGGGAGGACAATTGGTTGCAAGGAGGAACCATCCGAGCTATTGCACCCTCCATCTACGATCATGTCTCTACTCGTATCCGGAAGCGCCG[A/G]
ACGGTGGCTGAAGCGCTGTCTAACCGTAGATGGATCAAGGACATAAGAGGCGCGCTTGGGACTCAGGCAATACTTGAATACCTCAAACTTTGGTCGTTGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.40% 46.40% 0.17% 0.06% NA
All Indica  2759 29.20% 70.50% 0.22% 0.11% NA
All Japonica  1512 92.30% 7.60% 0.07% 0.00% NA
Aus  269 62.80% 36.80% 0.37% 0.00% NA
Indica I  595 50.30% 49.20% 0.50% 0.00% NA
Indica II  465 25.60% 73.80% 0.00% 0.65% NA
Indica III  913 14.20% 85.70% 0.11% 0.00% NA
Indica Intermediate  786 32.80% 66.90% 0.25% 0.00% NA
Temperate Japonica  767 96.90% 3.10% 0.00% 0.00% NA
Tropical Japonica  504 86.70% 13.30% 0.00% 0.00% NA
Japonica Intermediate  241 89.60% 10.00% 0.41% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 67.80% 32.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1126445759 T -> DEL LOC_Os11g43780.1 N frameshift_variant Average:49.777; most accessible tissue: Zhenshan97 flower, score: 62.374 N N N N
vg1126445759 T -> C LOC_Os11g43780.1 synonymous_variant ; p.Arg166Arg; LOW synonymous_codon Average:49.777; most accessible tissue: Zhenshan97 flower, score: 62.374 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1126445759 NA 3.37E-07 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126445759 NA 8.37E-08 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126445759 4.49E-06 NA mr1884 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126445759 1.39E-06 1.03E-13 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126445759 NA 6.17E-07 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126445759 NA 3.79E-06 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126445759 NA 2.18E-07 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126445759 NA 1.45E-06 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251