\
| Variant ID: vg1126346197 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 26346197 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.62, C: 0.37, others allele: 0.00, population size: 80. )
ATAGTAAGTAAAACACTATAAAATGTAAAAAAATAATTATATGTGCACATACTTTGTCCCATTCGACTTTCTCTTCTTCTCCTATCTCACTCAACTCCTC[C/T]
GTCTTACAATTTTTAACTAATTAACAACATAATAAAAAATGATCAATAATTACAAAGCTAAATAATTATGATTCTTATCTCATATCTGTTTTTTAGCTTA
TAAGCTAAAAAACAGATATGAGATAAGAATCATAATTATTTAGCTTTGTAATTATTGATCATTTTTTATTATGTTGTTAATTAGTTAAAAATTGTAAGAC[G/A]
GAGGAGTTGAGTGAGATAGGAGAAGAAGAGAAAGTCGAATGGGACAAAGTATGTGCACATATAATTATTTTTTTACATTTTATAGTGTTTTACTTACTAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.30% | 40.50% | 4.30% | 1.97% | NA |
| All Indica | 2759 | 48.30% | 45.60% | 3.62% | 2.54% | NA |
| All Japonica | 1512 | 62.90% | 30.80% | 5.42% | 0.93% | NA |
| Aus | 269 | 32.70% | 58.70% | 5.95% | 2.60% | NA |
| Indica I | 595 | 72.80% | 25.90% | 1.01% | 0.34% | NA |
| Indica II | 465 | 30.30% | 67.30% | 2.15% | 0.22% | NA |
| Indica III | 913 | 36.50% | 51.50% | 5.70% | 6.35% | NA |
| Indica Intermediate | 786 | 54.10% | 40.70% | 4.07% | 1.15% | NA |
| Temperate Japonica | 767 | 84.40% | 15.30% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 32.70% | 49.60% | 15.08% | 2.58% | NA |
| Japonica Intermediate | 241 | 57.70% | 40.70% | 1.24% | 0.41% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 56.70% | 35.60% | 5.56% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1126346197 | C -> T | LOC_Os11g43660.1 | upstream_gene_variant ; 4589.0bp to feature; MODIFIER | silent_mutation | Average:28.089; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg1126346197 | C -> T | LOC_Os11g43650-LOC_Os11g43660 | intergenic_region ; MODIFIER | silent_mutation | Average:28.089; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg1126346197 | C -> DEL | N | N | silent_mutation | Average:28.089; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1126346197 | NA | 2.62E-06 | mr1191 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126346197 | 1.29E-06 | 9.53E-09 | mr1295 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126346197 | 8.24E-07 | 4.05E-09 | mr1644 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126346197 | NA | 1.13E-10 | mr1769 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126346197 | NA | 2.88E-06 | mr1158_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126346197 | 2.98E-07 | 5.99E-13 | mr1191_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126346197 | NA | 1.14E-07 | mr1330_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126346197 | NA | 1.15E-06 | mr1336_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126346197 | NA | 1.31E-06 | mr1380_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126346197 | NA | 4.01E-06 | mr1561_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126346197 | NA | 5.21E-07 | mr1875_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126346197 | NA | 2.78E-06 | mr1908_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |