Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126292021:

Variant ID: vg1126292021 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 26292021
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

CTTCCTCCCAAGCTCTCAACATGAACCAGGAGCAGCCCTTCCCCCAAGCTCGTTGGATCCTGGTTCACCAAACAACCTTCGTCTCCTGTGCCACCCTCTC[A/G]
CTAGATAGACTCGGGCTCACTAAGGACCTTTGCCTCTCACGTTAGCCTCTCACCGGTCATATTTTGGCTTGCCGACGACCTCCTCCTACCTTGTTGCCCT

Reverse complement sequence

AGGGCAACAAGGTAGGAGGAGGTCGTCGGCAAGCCAAAATATGACCGGTGAGAGGCTAACGTGAGAGGCAAAGGTCCTTAGTGAGCCCGAGTCTATCTAG[T/C]
GAGAGGGTGGCACAGGAGACGAAGGTTGTTTGGTGAACCAGGATCCAACGAGCTTGGGGGAAGGGCTGCTCCTGGTTCATGTTGAGAGCTTGGGAGGAAG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.90%	7.80%	0.68%	14.62%	NA
All Indica	2759	67.00%	10.20%	0.87%	21.96%	NA
All Japonica	1512	93.70%	3.00%	0.07%	3.24%	NA
Aus	269	76.60%	12.60%	1.49%	9.29%	NA
Indica I	595	61.70%	5.70%	0.00%	32.61%	NA
Indica II	465	69.90%	10.30%	0.00%	19.78%	NA
Indica III	913	63.30%	15.20%	1.64%	19.82%	NA
Indica Intermediate	786	73.50%	7.60%	1.15%	17.68%	NA
Temperate Japonica	767	95.70%	3.50%	0.13%	0.65%	NA
Tropical Japonica	504	89.50%	3.20%	0.00%	7.34%	NA
Japonica Intermediate	241	95.90%	1.20%	0.00%	2.90%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	78.90%	5.60%	3.33%	12.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1126292021	A -> DEL	N	N	silent_mutation	Average:73.976; most accessible tissue: Zhenshan97 young leaf, score: 91.069	N	N	N	N
vg1126292021	A -> G	LOC_Os11g43560.1	upstream_gene_variant ; 742.0bp to feature; MODIFIER	silent_mutation	Average:73.976; most accessible tissue: Zhenshan97 young leaf, score: 91.069	N	N	N	N
vg1126292021	A -> G	LOC_Os11g43570.1	upstream_gene_variant ; 528.0bp to feature; MODIFIER	silent_mutation	Average:73.976; most accessible tissue: Zhenshan97 young leaf, score: 91.069	N	N	N	N
vg1126292021	A -> G	LOC_Os11g43580.1	upstream_gene_variant ; 2162.0bp to feature; MODIFIER	silent_mutation	Average:73.976; most accessible tissue: Zhenshan97 young leaf, score: 91.069	N	N	N	N
vg1126292021	A -> G	LOC_Os11g43560-LOC_Os11g43570	intergenic_region ; MODIFIER	silent_mutation	Average:73.976; most accessible tissue: Zhenshan97 young leaf, score: 91.069	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1126292021	3.99E-06	3.99E-06	mr1067	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126292021	2.31E-07	2.31E-07	mr1068	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126292021	7.57E-06	7.00E-07	mr1090	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126292021	1.57E-08	6.09E-16	mr1191	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126292021	4.10E-12	5.00E-15	mr1191	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126292021	NA	5.41E-06	mr1380	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126292021	6.86E-07	6.86E-07	mr1526	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126292021	NA	5.85E-06	mr1561	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126292021	8.15E-06	8.15E-06	mr1598	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126292021	9.20E-13	1.72E-21	mr1644	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126292021	4.54E-14	7.73E-20	mr1644	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126292021	NA	3.46E-06	mr1908	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126292021	4.49E-06	4.49E-06	mr1945	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126292021	3.40E-09	2.17E-21	mr1191_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126292021	8.51E-14	1.11E-19	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251