\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126292021:

Variant ID: vg1126292021 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 26292021
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


CTTCCTCCCAAGCTCTCAACATGAACCAGGAGCAGCCCTTCCCCCAAGCTCGTTGGATCCTGGTTCACCAAACAACCTTCGTCTCCTGTGCCACCCTCTC[A/G]
CTAGATAGACTCGGGCTCACTAAGGACCTTTGCCTCTCACGTTAGCCTCTCACCGGTCATATTTTGGCTTGCCGACGACCTCCTCCTACCTTGTTGCCCT

Reverse complement sequence

AGGGCAACAAGGTAGGAGGAGGTCGTCGGCAAGCCAAAATATGACCGGTGAGAGGCTAACGTGAGAGGCAAAGGTCCTTAGTGAGCCCGAGTCTATCTAG[T/C]
GAGAGGGTGGCACAGGAGACGAAGGTTGTTTGGTGAACCAGGATCCAACGAGCTTGGGGGAAGGGCTGCTCCTGGTTCATGTTGAGAGCTTGGGAGGAAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.90% 7.80% 0.68% 14.62% NA
All Indica  2759 67.00% 10.20% 0.87% 21.96% NA
All Japonica  1512 93.70% 3.00% 0.07% 3.24% NA
Aus  269 76.60% 12.60% 1.49% 9.29% NA
Indica I  595 61.70% 5.70% 0.00% 32.61% NA
Indica II  465 69.90% 10.30% 0.00% 19.78% NA
Indica III  913 63.30% 15.20% 1.64% 19.82% NA
Indica Intermediate  786 73.50% 7.60% 1.15% 17.68% NA
Temperate Japonica  767 95.70% 3.50% 0.13% 0.65% NA
Tropical Japonica  504 89.50% 3.20% 0.00% 7.34% NA
Japonica Intermediate  241 95.90% 1.20% 0.00% 2.90% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 78.90% 5.60% 3.33% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1126292021 A -> DEL N N silent_mutation Average:73.976; most accessible tissue: Zhenshan97 young leaf, score: 91.069 N N N N
vg1126292021 A -> G LOC_Os11g43560.1 upstream_gene_variant ; 742.0bp to feature; MODIFIER silent_mutation Average:73.976; most accessible tissue: Zhenshan97 young leaf, score: 91.069 N N N N
vg1126292021 A -> G LOC_Os11g43570.1 upstream_gene_variant ; 528.0bp to feature; MODIFIER silent_mutation Average:73.976; most accessible tissue: Zhenshan97 young leaf, score: 91.069 N N N N
vg1126292021 A -> G LOC_Os11g43580.1 upstream_gene_variant ; 2162.0bp to feature; MODIFIER silent_mutation Average:73.976; most accessible tissue: Zhenshan97 young leaf, score: 91.069 N N N N
vg1126292021 A -> G LOC_Os11g43560-LOC_Os11g43570 intergenic_region ; MODIFIER silent_mutation Average:73.976; most accessible tissue: Zhenshan97 young leaf, score: 91.069 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1126292021 3.99E-06 3.99E-06 mr1067 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126292021 2.31E-07 2.31E-07 mr1068 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126292021 7.57E-06 7.00E-07 mr1090 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126292021 1.57E-08 6.09E-16 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126292021 4.10E-12 5.00E-15 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126292021 NA 5.41E-06 mr1380 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126292021 6.86E-07 6.86E-07 mr1526 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126292021 NA 5.85E-06 mr1561 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126292021 8.15E-06 8.15E-06 mr1598 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126292021 9.20E-13 1.72E-21 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126292021 4.54E-14 7.73E-20 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126292021 NA 3.46E-06 mr1908 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126292021 4.49E-06 4.49E-06 mr1945 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126292021 3.40E-09 2.17E-21 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126292021 8.51E-14 1.11E-19 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251